Skip to main content
  • AACR Publications
    • Blood Cancer Discovery
    • Cancer Discovery
    • Cancer Epidemiology, Biomarkers & Prevention
    • Cancer Immunology Research
    • Cancer Prevention Research
    • Cancer Research
    • Clinical Cancer Research
    • Molecular Cancer Research
    • Molecular Cancer Therapeutics

AACR logo

  • Register
  • Log in
  • My Cart
Advertisement

Main menu

  • Home
  • About
    • The Journal
    • AACR Journals
    • Journal Sections
    • Subscriptions
    • Reviewing
    • Permissions and Reprints
  • Articles
    • OnlineFirst
    • Current Issue
    • Past Issues
    • Collections
      • COVID-19 & Cancer Resource Center
      • Clinical Trials
      • Immuno-oncology
      • Editors' Picks
      • "Best of" Collection
  • For Authors
    • Information for Authors
    • Author Services
    • Best of: Author Profiles
    • Submit
  • Alerts
    • Table of Contents
    • Editors' Picks
    • OnlineFirst
    • Citation
    • Author/Keyword
    • RSS Feeds
    • My Alert Summary & Preferences
  • News
    • Cancer Discovery News
    • Journal Press Releases
  • COVID-19
  • Webinars
  • 10th Anniversary
  • Search More

    Advanced Search

  • AACR Publications
    • Blood Cancer Discovery
    • Cancer Discovery
    • Cancer Epidemiology, Biomarkers & Prevention
    • Cancer Immunology Research
    • Cancer Prevention Research
    • Cancer Research
    • Clinical Cancer Research
    • Molecular Cancer Research
    • Molecular Cancer Therapeutics

User menu

  • Register
  • Log in
  • My Cart

Search

  • Advanced search
Cancer Discovery
Cancer Discovery
  • Home
  • About
    • The Journal
    • AACR Journals
    • Journal Sections
    • Subscriptions
    • Reviewing
    • Permissions and Reprints
  • Articles
    • OnlineFirst
    • Current Issue
    • Past Issues
    • Collections
      • COVID-19 & Cancer Resource Center
      • Clinical Trials
      • Immuno-oncology
      • Editors' Picks
      • "Best of" Collection
  • For Authors
    • Information for Authors
    • Author Services
    • Best of: Author Profiles
    • Submit
  • Alerts
    • Table of Contents
    • Editors' Picks
    • OnlineFirst
    • Citation
    • Author/Keyword
    • RSS Feeds
    • My Alert Summary & Preferences
  • News
    • Cancer Discovery News
    • Journal Press Releases
  • COVID-19
  • Webinars
  • 10th Anniversary
  • Search More

    Advanced Search

Research Articles

Repression of the Type I Interferon Pathway Underlies MYC- and KRAS-Dependent Evasion of NK and B Cells in Pancreatic Ductal Adenocarcinoma

Nathiya Muthalagu, Tiziana Monteverde, Ximena Raffo-Iraolagoitia, Robert Wiesheu, Declan Whyte, Ann Hedley, Sarah Laing, Björn Kruspig, Rosanna Upstill-Goddard, Robin Shaw, Sarah Neidler, Curtis Rink, Saadia A. Karim, Katarina Gyuraszova, Colin Nixon, William Clark, Andrew V. Biankin, Leo M. Carlin, Seth B. Coffelt, Owen J. Sansom, Jennifer P. Morton and Daniel J. Murphy
Nathiya Muthalagu
1CRUK Beatson Institute, Glasgow, Scotland, United Kingdom.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Tiziana Monteverde
2Institute of Cancer Sciences, University of Glasgow, Glasgow, Scotland, United Kingdom.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • ORCID record for Tiziana Monteverde
Ximena Raffo-Iraolagoitia
1CRUK Beatson Institute, Glasgow, Scotland, United Kingdom.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Robert Wiesheu
2Institute of Cancer Sciences, University of Glasgow, Glasgow, Scotland, United Kingdom.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • ORCID record for Robert Wiesheu
Declan Whyte
2Institute of Cancer Sciences, University of Glasgow, Glasgow, Scotland, United Kingdom.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Ann Hedley
1CRUK Beatson Institute, Glasgow, Scotland, United Kingdom.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Sarah Laing
2Institute of Cancer Sciences, University of Glasgow, Glasgow, Scotland, United Kingdom.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • ORCID record for Sarah Laing
Björn Kruspig
2Institute of Cancer Sciences, University of Glasgow, Glasgow, Scotland, United Kingdom.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Rosanna Upstill-Goddard
3Wolfson Wohl Translational Cancer Research Centre, University of Glasgow, Glasgow, Scotland, United Kingdom.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • ORCID record for Rosanna Upstill-Goddard
Robin Shaw
1CRUK Beatson Institute, Glasgow, Scotland, United Kingdom.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Sarah Neidler
2Institute of Cancer Sciences, University of Glasgow, Glasgow, Scotland, United Kingdom.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • ORCID record for Sarah Neidler
Curtis Rink
1CRUK Beatson Institute, Glasgow, Scotland, United Kingdom.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Saadia A. Karim
1CRUK Beatson Institute, Glasgow, Scotland, United Kingdom.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • ORCID record for Saadia A. Karim
Katarina Gyuraszova
2Institute of Cancer Sciences, University of Glasgow, Glasgow, Scotland, United Kingdom.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Colin Nixon
1CRUK Beatson Institute, Glasgow, Scotland, United Kingdom.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
William Clark
1CRUK Beatson Institute, Glasgow, Scotland, United Kingdom.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Andrew V. Biankin
3Wolfson Wohl Translational Cancer Research Centre, University of Glasgow, Glasgow, Scotland, United Kingdom.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • ORCID record for Andrew V. Biankin
Leo M. Carlin
1CRUK Beatson Institute, Glasgow, Scotland, United Kingdom.
2Institute of Cancer Sciences, University of Glasgow, Glasgow, Scotland, United Kingdom.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • ORCID record for Leo M. Carlin
Seth B. Coffelt
1CRUK Beatson Institute, Glasgow, Scotland, United Kingdom.
2Institute of Cancer Sciences, University of Glasgow, Glasgow, Scotland, United Kingdom.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • ORCID record for Seth B. Coffelt
Owen J. Sansom
1CRUK Beatson Institute, Glasgow, Scotland, United Kingdom.
2Institute of Cancer Sciences, University of Glasgow, Glasgow, Scotland, United Kingdom.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Jennifer P. Morton
1CRUK Beatson Institute, Glasgow, Scotland, United Kingdom.
2Institute of Cancer Sciences, University of Glasgow, Glasgow, Scotland, United Kingdom.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • For correspondence: daniel.murphy@glasgow.ac.uk Jennifer.morton@glasgow.ac.uk
Daniel J. Murphy
1CRUK Beatson Institute, Glasgow, Scotland, United Kingdom.
2Institute of Cancer Sciences, University of Glasgow, Glasgow, Scotland, United Kingdom.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • ORCID record for Daniel J. Murphy
  • For correspondence: daniel.murphy@glasgow.ac.uk Jennifer.morton@glasgow.ac.uk
DOI: 10.1158/2159-8290.CD-19-0620 Published June 2020
  • Article
  • Figures & Data
  • Info & Metrics
  • PDF
Loading

Abstract

MYC is implicated in the development and progression of pancreatic cancer, yet the precise level of MYC deregulation required to contribute to tumor development has been difficult to define. We used modestly elevated expression of human MYC, driven from the Rosa26 locus, to investigate the pancreatic phenotypes arising in mice from an approximation of MYC trisomy. We show that this level of MYC alone suffices to drive pancreatic neuroendocrine tumors, and to accelerate progression of KRAS-initiated precursor lesions to metastatic pancreatic ductal adenocarcinoma (PDAC). Our phenotype exposed suppression of the type I interferon (IFN) pathway by the combined actions of MYC and KRAS, and we present evidence of repressive MYC–MIZ1 complexes binding directly to the promoters of the genes encodiing the type I IFN regulators IRF5, IRF7, STAT1, and STAT2. Derepression of IFN regulator genes allows pancreatic tumor infiltration by B and natural killer (NK) cells, resulting in increased survival.

Significance: We define herein a novel mechanism of evasion of NK cell–mediated immunity through the combined actions of endogenously expressed mutant KRAS and modestly deregulated expression of MYC, via suppression of the type I IFN pathway. Restoration of IFN signaling may improve outcomes for patients with PDAC.

This article is highlighted in the In This Issue feature, p. 747

Introduction

Cancers of the pancreas are projected to become the second most frequent cause of cancer-related mortality worldwide by 2030 (1). Ductal adenocarcinoma comprises up to 95% of pancreatic cancers, and neuroendocrine tumors (PNET) and other exocrine tumors account for remainder (https://www.pancreaticcancer.org.uk/; https://seer.cancer.gov/statistics/). The 5-year survival rate for pancreatic ductal adenocarcinoma (PDAC) is extremely low at 3% to 5%, and although that for PNET is considerably higher (30%–50%), neither cancer responds effectively to current treatment modalities (2). There is therefore a pressing need to further our understanding of the underlying biology of these cancers.

Activating mutations in KRAS occur in up to 93% of PDAC, while the majority of KRAS wild-type (WT) cases bear alternative genetic alterations predicted to result in ectopic RAS–ERK pathway activity, implying a critical requirement for this pathway in PDAC (3, 4). Experiments in genetically altered mice have however demonstrated that KRAS activation alone is insufficient for PDAC development: Cre-dependent activation of the endogenously expressed Lsl-KrasG12D allele (5) alone gives rise predominantly to low-grade pancreatic intraepithelial neoplasms (PanIN), a subset of which may spontaneously progress to PDAC through the acquisition of additional mutations (6–8). Recent genomic characterization of cell lines generated from such spontaneously progressing tumors revealed increased KRASG12D allelic dosage as one of the most frequently recurring genetic alterations associated with progression (9), suggesting that the volume of signaling flux through the RAS pathway is rate-limiting for PDAC progression, as was recently shown for KRAS-driven lung cancer (10–13). Interestingly, cell lines that lacked increased KRASG12D allelic dosage contained amplifications of alternative oncogenes that encode proteins that may serve as potentially rate-limiting RAS effectors, including MYC, YAP1, and NF-κB (9, 14). MYC in particular is widely reported to be overexpressed in PDAC, with a propensity for low-level amplification suggesting that subtle changes in MYC expression may suffice to affect PDAC development (15, 16). Accordingly, expression of murine Myc from the Rosa26 locus was recently shown to accelerate progression to PDAC; however, the use of murine Myc cDNA in the transgene precluded a precise determination of the level of MYC deregulation required for tumor progression (17). Conversely, deletion/depletion of endogenous Myc profoundly delayed progression of PDAC driven by KRASG12D and loss of p53 (18, 19), and RNAi-mediated depletion of MYC in human PDAC cells suppressed proliferation in vitro and xenograft tumorigenesis in vivo (20), consistent with the hypothesis that MYC is a critical rate-limiting effector of KRAS in this cancer.

Here, we directly investigated the level of MYC deregulation required for pancreatic tumor development using conditional expression of human MYC from the Rosa26 locus at levels that approximate expression of endogenous Myc. We show that modestly deregulated expression of MYC alone suffices to drive PNET development and dramatically accelerates progression to metastatic PDAC when combined with KRAS activation. In PDAC, the combination of MYC and KRASG12D suppresses tumor infiltration of effector immune populations, as recently reported (21). Mechanistically, we reveal that MYC and KRASG12D cooperatively regulate gene expression, with particular convergence on repression of the type I interferon (IFN) pathway. We show that targeted suppression of the MYC–MIZ1 transcriptional repressor complex (22) restores IFN-related gene expression and consequent B cell– and natural killer (NK) cell–mediated immune surveillance. Our data reveal a mechanism of immune evasion driven by two of the most commonly dysregulated oncogenes in human cancer.

Results

Rosa26-Driven MYC Is Expressed at Near-Physiologic Levels

To define the level of MYC deregulation required for pancreatic tumor development, we used Rosa26DM-lsl-MYC mice wherein the human MYC cDNA, preceded by a floxed translational stop cassette, was inserted into the murine Rosa26 locus by homologous recombination, as described previously (23). Use of the human cDNA facilitated the distinction between endogenously expressed murine Myc and Rosa26-driven MYC. RT-PCR demonstrated Cre-dependent expression of human MYC in Rosa26DM-lsl-MYC/+- and Rosa26DM-lsl-MYC/lsl-MYC-derived mouse embryonic fibroblasts (MEF) within 24 hours of infection with Adeno-Cre. Expression of one copy of human MYC mRNA was comparable with murine Myc, whereas two copies yielded modestly supraphysiologic expression (Fig. 1A). Consistent with previous reports that MYC regulates its own transcription (24), Rosa26MYC/MYC MEFs exhibited reduced expression of endogenous Myc and were modestly sensitized to apoptosis upon serum withdrawal (Fig. 1B). At the protein level, activation of Rosa26DM-lsl-MYC/+ drove modestly higher expression of MYC compared with WT MEFs. Notably, Cre-dependent activation of endogenously expressed Lsl-KrasG12D also drove higher expression of MYC protein, comparable to that arising from Rosa26MYC/+, and expression was higher again upon combined activation of both alleles (Fig. 1C).

Figure 1.
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 1.

Rosa26-driven MYC is expressed at near physiologic levels. A, RT-PCR comparison of Rosa26-driven MYC with endogenously expressed Myc in Rosa26WT/WT, Rosa26DM-lsl-MYC/+, and Rosa26DM-lsl-MYC/lsl-MYC MEFs, 24 hours after infection with Adeno-Cre. N = 3; *, P < 0.05; ANOVA and post hoc Tukey test. ND, not detected. B, FACS analysis of Annexin V (AV), propidium iodide (PI) labeling of MEFs, infected as per A with Adeno-Cre or Adeno-LacZ and cultured overnight in 0.2% FBS. N = 3; **, P < 0.01; ANOVA with post hoc Tukey test. C, Immunoblot of MYC expression in WT, Rosa26DM-lsl-MYC/+, Lsl-KrasG12D, and Rosa26DM-lsl-MYC/+;Lsl-KrasG12D (double positive) MEFs 24 hours after Adeno-Cre infection. Image is representative of >3 experiments.

Deregulated MYC Drives Pancreatic Tumor Development and Progression

RAS pathway activity elevates MYC expression in pancreatic cancer, primarily via suppression of MYC protein turnover, and MYC was previously shown using RNAi to be required for proliferation of PDAC cells in culture (20, 25, 26). Use of the PICKLES database of CRISPR-mediated essentiality screening (27) confirmed the requirement for MYC to sustain the fitness of all PDAC lines examined, including several lines that do not require KRAS (Supplementary Fig. S1A). We asked whether MYC expressed from the Rosa26 locus is sufficient for tumor formation. We interbred Rosa26DM-lsl-MYC mice (M) with pancreas-specific Pdx1-Cre mice (C), with and without the Lsl-KrasG12D allele (K), and aged mice until humane clinical endpoints were reached. Pdx1-Cre–positive mice carrying one (MC) or two (M2C) copies of Rosa26DM-lsl-MYC developed pancreatic tumors requiring euthanasia at a median age of 297 or 180 days, respectively. The combination of Lsl-KrasG12D and one copy of Rosa26DM-lsl-MYC (KMC) yielded a dramatically accelerated tumor phenotype requiring euthanasia at a median age of just 50 days, as compared with KC mice, which had a median survival >350 days (Fig. 2A–C). In contrast with KC mice, which developed mostly ductal epithelial PanIN lesions with infrequent progression to PDAC, as reported previously (6), MC and M2C pancreata showed no evidence of ductal epithelial phenotypes and instead presented with PNETs characterized by densely populated cells that stained strongly for the neuroendocrine marker synaptophysin and faintly positive for cytokeratin (Fig. 2D; Supplementary Fig. S1B). This PNET phenotype was largely masked upon inclusion of the Lsl-KrasG12D allele: Rapidly arising tumors in KMC mice displayed a predominantly ductal adenocarcinoma phenotype (PDAC), complete with characteristic desmoplastic stroma, whereas <5% of tissue area exhibited PNET features (Supplementary Fig. S1B and S1C). PNET regions in KMC tumors expressed KRASG12D (Supplementary Fig. S1D), indicating that the persistence of this phenotype does not arise from failure to activate the Lsl-KrasG12D allele in a subset of pancreatic tumor–initiating cells.

Figure 2.
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 2.

Pancreatic cancer phenotypes induced by activation of Rosa26-driven MYC with and without KRASG12D. A, Schematic of alleles used in B–D. B, Overall survival of MC (N = 9) and M2C (N = 11) mice. Mantel–Cox log rank test (B, C, and F). C, Overall survival of KC (N = 65) versus MC (from B) and KMC (N = 19) mice. Black hash marks indicate mice that were euthanized for reasons unrelated to pancreatic cancer. D, Representative images show tumor histology [hematoxylin and eosin (H&E)] and IHC detection of total MYC and KRASG12D expression in end-stage tumors of mice of the indicated genotypes. Scale bar, 100 μm. E, Schematic of alleles used in F–H. F, Overall survival of MCER (N = 5), M2CER (N = 6), and KMCER (N = 10) mice measured in days post induction with tamoxifen. G, Representative H&E images of ductal tumor progression in KMCER mice. Scale bars, 100 μm. H, Licor PEARL fluorescent imaging of IRFP-expressing metastases in KMCER mice (top). Liver metastases (left), diaphragm metastases (right). H&E and IHC for pan-cytokeratin and synaptophysin (bottom). Scale bars, 100 μm. **, P < 0.01; ***, P < 0.001.

Sporadic Adult Activation of Rosa26DM-lsl-MYC and Lsl-KrasG12D Drives Metastatic Cancer

The Pdx1 promoter is active from embryonic day 8.5 (28), raising the possibility that blockade of pancreatic progenitor cell differentiation might explain the MYC-dependent neuroendocrine and accelerated PDAC phenotypes. To address this, we substituted the constitutively active Pdx1-Cre allele with a Pdx1-Cre-ER allele (CER) which expresses an inactive Cre–estrogen receptor ligand–binding domain fusion protein that can be activated by the synthetic ligand tamoxifen (29). KMCER mice were additionally interbred with mice carrying a Hprt-Lsl-IRFP Cre-reporter allele (30), to facilitate imaging of tumor populations (Fig. 2E). Cre-ER was transiently activated in mice ages 5 to 6 weeks by 3 days of tamoxifen injection, and mice were aged to clinical endpoint. As was found using the constitutively active Cre, all M2CER mice developed neuroendocrine tumors, reaching median endpoint at 275 days from the date of induction, although the majority of MCER mice failed to develop symptomatic disease within 400 days. KMCER mice all developed PDAC, reaching median endpoint at 128 days post-induction (Fig. 2F). Periodic sampling of KMCER pancreatic tissue following Cre-ER activation showed temporal progression of incipient tumors from PanIN-1 through PDAC (Fig. 2G). Furthermore, the IRFP allele revealed metastases in 6 of 10 mice, of which 4 had liver metastases and 4 had diaphragm metastases, including 2 mice with both (Fig. 2H). As observed with KMC tumors, KMCER tumors contained regions (∼15% of tumor area) of PNET (Supplementary Fig. S1C). All liver metastases histologically resembled the PNET phenotype and all stained strongly for synaptophysin. In contrast, diaphragm metastases all histologically resembled PDAC, but also contained discrete regions where cells stained strongly for either cytokeratin or synaptophysin, suggestive of phenotypic plasticity in the metastatic population (Fig. 2H). Accordingly, synaptophysin–cytokeratin double-positive cells could be identified in the ductal epithelium of primary tumors (Supplementary Fig. S1E), as previously reported using the embryonically active Pdx1-Cre allele (17). The accelerated tumor phenotypes observed upon MYC deregulation can thus arise in fully developed adult tissues.

Endogenous Myc Is Required for KMC Tumor Development

Given the modest expression of Rosa26-driven MYC in MEFs, we asked whether autochthonously expressed Myc contributes meaningfully to the total pool of MYC protein in the KMC model. Note that whereas KRAS activation does not affect transcription from the Rosa26 locus, which we previously showed is refractory to growth factor signaling (31), post-translation regulation of MYC protein by RAS pathway activation should affect murine and human MYC protein equally (32). Accordingly, deletion of floxed murine Myc in MEFs reduced the total pool of MYC protein by approximately 50%, despite concurrent activation of Rosa26DM-lsl-MYC and Lsl-KrasG12D alleles (Fig. 3A). KMC mice interbred with Mycfl/fl mice were aged until humane endpoints were reached. KMC mice heterozygous for floxed Myc showed significantly increased survival, and survival was increased further in homozygous Mycfl/fl mice (Fig. 3B and C). Nevertheless, all mice developed PDAC. Examination of murine Myc by ISH revealed a mosaic pattern of continued expression of murine Myc in much of the ductal epithelium of all KMC-Mycfl/fl tumors examined, indicating escape from Cre-mediated deletion and suggesting a selective pressure to retain expression of endogenous Myc despite the presence of Rosa26-driven MYC (Supplementary Fig. S2A and S2B). This MYC dose dependence was also evident in human PDAC cell lines, wherein depletion of MYC suppressed cell proliferation (Supplementary Fig. S2C), consistent with previous reports (20). These data strongly suggest that the level of MYC expression is rate-limiting for pancreatic tumor progression and, in KMC mice, both Rosa26-driven MYC and endogenously expressed Myc functionally contribute to the total pool of MYC protein.

Figure 3.
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 3.

MYC expression levels modulate effector immune cell infiltration in PDAC. A, Genetic deletion of endogenous Myc in Rosa26DM-lsl-MYC;Lsl-KrasG12D MEFs. Lysates were prepared 24 hours after Adeno-Cre infection. Representative of two independent experiments. B, Schematic of alleles used in C–H. C, Overall survival of KMC mice with 0 (N = 19; from Fig. 2C), 1 (N = 13), or 2 (N = 8) copies of Mycfl. Mantel–Cox log rank test. D, Normalized RNA-seq reads of indicated B-cell markers in KC (N = 6) and KMC (N = 6) pancreatic tumors. Note that samples with zero reads are absent from log-scale graphics (pertains only to KMC samples). Adjusted P values were generated in R (D, E, and H). E, Normalized RNA-seq reads of indicated NK-cell markers in KC (N = 6) and KMC (N = 6) pancreatic tumors. F, Quantification of tumor-infiltrating NK (NKp46+) and B (CD45R+) cells in KC (N = 7), KMC (N = 10), and KMC-Mycfl/fl (N = 9 and 12, respectively) pancreatic tumors. Kruskal–Wallis and Dunn multiple comparison test. G, Representative images of IHC staining for NKp46+ NK cells (top) and CD45R+ B cells (bottom), as per F. Scale bars, 100 μm. H, RNA-seq reads of NK-cell killer-type lectin receptor genes in KMC (N = 6) versus KMC-Mycfl/+ (N = 4) tumors. For all panels, ***, P < 0.001; **, P < 0.01; *, P < 0.05.

MYC Suppresses Immune Cell Infiltration in PDAC

To gain insight into the functional roles of MYC in PDAC, we performed bulk-tumor RNA sequencing (RNA-seq) on six KC, six KMC, and four KMC-Mycfl/+ end-stage tumors. Note that homozygous KMC-Mycfl/fl mice were omitted from RNA-seq analysis given that the failure of Cre recombinase to efficiently delete both copies of endogenous Myc would likely confound interpretation. MetaCore GeneGo analysis revealed a pronounced reduction in immune cell–related gene expression in KMC relative to KC tumors (Supplementary Fig. S3). Specifically, we found reduced expression of genes encoding T-cell markers, including CD3, CD4, and CD8 (Supplementary Fig. S4A); B-cell immunoglobulin genes, including those encoding multiple constant heavy and light chains along with joining regions; and NK-cell genes, including natural killer triggering receptor (Nktr) and killer-type lectin receptor genes (Fig. 3D and E). IHC for markers of B (CD45R) and NK (NKp46) cells confirmed their reduced presence in KMC PDAC (Fig. 3F and G). Reduction of total MYC by deletion of endogenous Myc reversed the exclusion of B and NK cells but did not significantly influence T-cell infiltration (Fig. 3F and G; Supplementary Fig. S4B and S4C). RNA-seq analysis showed increased expression of multiple killer-type lectin receptor genes, indicative of NK-cell activation and memory (33), upon reduction of MYC in KMC tumors (Fig. 3H). Taken together with Figs. 1 and 2, these data show that subtle differences in MYC expression profoundly modulate long-term immune cell infiltration in PDAC, extending a recent report of acute immune modulation by MYC using a tamoxifen-dependent variant allele, Rosa26-Lsl-MycERT2 (21).

Suppression of the Type I IFN Pathway by MYC and KRAS

MYC was previously shown to modulate the immune landscape in KRAS-driven lung adenocarcinoma via CCL9-dependent recruitment of protumor macrophages and IL23-dependent exclusion of T, B, and NK cells (34). Expression of Ccl9 was not significantly altered in our RNA-seq datasets and we found no difference in the number of macrophages present in end-stage KMC versus KMC-Mycfl/fl tumors (Supplementary Fig. S4D and S4E). Functional IL23 comprises a heterodimer of p19 and p40 subunits, encoded by IL23a and IL12b, respectively (35). Although Il23a expression was higher in KMC versus KC tumors and significantly reduced in KMC-Mycfl/+ tumors, the gene encoding its dimerization partner Il12b showed opposite regulation (Supplementary Fig. S4F), strongly suggesting that IL23 does not account for the immunosuppressive phenotype driven by MYC in PDAC. Expression of Gas6, recently reported to be induced upon acute MYC activation in PanIN lesions (21), was unchanged in end-stage tumors (Supplementary Fig. S4G). We therefore sought an alternative explanation for MYC-driven immunosuppression.

Type I IFN signaling via JAK–STAT was among the most strongly suppressed pathways (ranked 6th) in KMC tumors relative to KC tumors (Supplementary Fig. S3). Taking advantage of our ability to acutely induce expression of floxed MYC and KRASG12D in otherwise WT primary cells, we asked which pathways were regulated upon acute activation of MYC and/or KRAS in MEFs. Early-passage MEFs carrying Rosa26-Lsl-MycDM, Lsl-KrasG12D, or both, were infected with Adeno-Cre overnight in full growth medium and their gene expression was compared with that of similarly infected WT littermate MEFs. Consistent with positive regulation of MYC by activated KRAS (Fig. 1), we found a pronounced overlap in the transcriptomic impact of activation of either oncogene alone (Supplementary Fig. S5A–S5C; Supplementary Tables S1–S3). Similar to our comparison between KMC and KC tumors, GeneGo analysis identified type I IFN signaling via JAK–STAT as the most significantly downregulated pathway upon combined activation of MYC and KRAS alleles (Supplementary Fig. S5D). Interrogation of the data at the single-gene level showed reduced expression of multiple IFN-induced genes, multiple IFN regulatory factors, and genes encoding STAT1 and STAT2, which combine with IRF9 to form the ISGF3 complex (36). Although several of these effects were evident with activation of either MYC or KRASG12D alone, regulation was most pronounced upon combined oncogene activation (Fig. 4A; Supplementary Fig. S5D).

Figure 4.
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 4.

MYC and KRASG12D suppress the type I IFN pathway. A, RNA-seq analysis of indicated gene expression in Rosa26WT/WT (WT), Rosa26DM-lsl-MYC/+(MYC), Lsl-KrasG12D (KRAS), and Rosa26DM-lsl-MYC/+;Lsl-KrasG12D (MYC and KRAS) MEFs, 24 hours after infection with Adeno-Cre. Adjusted P values were generated in R (A and C). B, Heat map of significant gene-expression changes induced by depletion of MYC and KRAS in KMC-derived cultured PDAC cells compared with nontargeting (NT) control, analyzed by RNA-seq. N = 4 biological replicates. C, RNA-seq analysis of the indicated genes upon depletion of MYC or KRAS in KMC PDAC cells, as per B. D, Reduced expression of MYC in human PDAC cells treated with trametinib (T), compared with DMSO vehicle (D). Representative of three individual experiments. E, RT-PCR analysis of IFN-related gene expression in human PDAC cell lines treated +/−trametinib. Mean and SEM shown for N = 3 biological replicates. For all panels, ***, P < 0.001; **, P < 0.01; *, P < 0.05; ns, not significant.

We next compared the transcriptomic impact of acute depletion of MYC or KRAS from KMC-derived tumor cell lines. As was observed in MEFs, we found a pronounced overlap in significantly regulated genes altered in murine PDAC cells upon depletion of either Myc or Kras (Fig. 4B; Supplementary Fig. S5E). Notably, the type I IFN pathway was again among the topmost regulated pathways in both instances (Supplementary Fig. S5F), with increased expression of the ISGF3 complex subunits, multiple Irfs, IFN receptor genes, and IFN-induced genes detected upon depletion of either oncogene. These effects were typically stronger upon Kras depletion, and some Irf genes (e.g., Irf5) were regulated by KRAS but not by MYC in this analysis, perhaps reflecting the limits of transcript detection at the sequencing read-depth used (Fig. 4C). To extend these data to the human setting, we treated PDAC cell lines with the MEK1/2 inhibitor trametinib, which acutely reduced expression of MYC downstream of KRAS (Fig. 4D). In both AsPC-1 and DAN-G cells, trametinib increased expression of IRF5, IRF7, IFNB1, and a representative IFN-inducible gene, IFI44 (Fig. 4E). We conclude from these experiments that MYC and KRAS cooperate to suppress the type I IFN pathway.

The Role of MIZ1 in Suppression of IFN Regulators by MYC

In many instances, MYC-dependent transcriptional repression involves binding to the MYC-interacting zinc finger protein MIZ1, encoded by ZBTB17 (18, 37). We therefore investigated the acute impact of Miz1 depletion in KMC PDAC cells in vitro. Transcriptomic analysis revealed that depletion of Miz1 upregulated approximately 60% of the same genes upregulated upon depletion of MYC from KMC cells (Fig. 5A; Supplementary Table S4). Using q-PCR, we determined that depletion of Miz1 or Myc specifically increased expression of Irf5, Irf7, Ifnb1, and Ifi44 (Figs. 5B; Supplementary Fig. S6A), as was found upon trametinib treatment of human PDAC cells. Chromatin immunoprecipitation (ChIP) analyses showed MYC binding to the promoters of STAT1, STAT2, IRF5, and IRF7 in DAN-G cells (Fig. 5C). ChIP–re-ChIP using a MIZ1 antibody showed efficient recovery of the same IRF and STAT promoter fragments initially precipitated a MYC but absent from control IgG precipitates, strongly suggesting that MYC and MIZ1 form repressive complexes on the STAT1, STAT2, IRF5, and IRF7 promoters (Fig. 5D; Supplementary Fig. S6B), as previously reported for the Stat1 promoter in murine KPC PDAC cells (18). To investigate the functional role of MIZ1 in vivo, we used Miz1ΔPOZ mice (38) in which the sequence encoding the MYC-interacting POZ domain of MIZ1 is flanked by LoxP sites (Fig. 5E). Efficient deletion of the MIZ1 POZ domain in KMC-Miz1fl/fl mice was verified by ISH and significantly extended the life span of tumor-bearing mice (Fig. 5F; Supplementary Fig. S6C). PDAC subtype analysis performed as per Bailey and colleagues (3) revealed that deletion of either Myc or Miz1 significantly increased the immunogenic subtype signature but did not significantly alter any of the other subtypes (Supplementary Fig. S6D). As was observed upon deletion of endogenous Myc, deletion of Miz1 restored tumor infiltration of NK and B cells (Fig. 5G). Antibody-mediated blockade of the type I IFN receptor IFNAR suppressed NK- and B-cell infiltration and negated the survival benefit of Miz1 deletion in tumor-bearing KMC mice (Fig. 5H–J), implicating IFN signaling in lymphocyte recruitment and in the survival benefit observed upon Miz1 deletion.

Figure 5.
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 5.

Transcriptional repression of the type I IFN pathway by MYC–MIZ1. A, Heat map of gene-expression changes induced by RNAi-mediated depletion of MYC or Miz1 in KMC-derived cultured PDAC cells compared with nontargeting control, analyzed by RNA-seq. N = 4 biological replicates. B, RT-PCR analysis of IFN-related gene expression in KMC tumor cells upon siRNA-mediated depletion of Miz1 compared with nontargeting control. Mean and SEM of three independent experiments shown. t test. C, ChIP analysis of MYC and MIZ1 binding to the promoters of the indicated genes in human DAN-G PDAC cells compared with a known MYC–MIZ1 target, VAMP4. Mean and SEM of technical replicates from 1 of 3 independent experiments shown. ANOVA and Tukey multiple comparison test. D, Re-ChIP analysis of MIZ1 binding to anti-MYC–precipitated promoter regions. Mean and SEM of technical replicates from 1 of 3 independent experiments shown. t test. E, Schematic of alleles used in F–J. F, Overall survival of KMC (N = 19; from Fig. 2C) and KMC-Miz1fl/fl (N = 12) mice. ***, P < 0.001; Mantel–Cox log rank test (F and J). G, Quantification of tumor-infiltrating NK (NKp46+) and B (CD45R+) cells in KMC and KMC-Miz1fl/fl pancreatic tumors. Mann–Whitney test (G and I). H, IHC detection of tumor-infiltrating NK and B cells after 3 weeks of IFNAR1 blockade in KMC-Miz1fl/fl PDAC. Scale bars, 100 μm. I, Quantification of tumor-infiltrating NK (NKp46+) and B (CD45R+) cells in untreated (NT; N = 11 and 10, respectively; from G) versus IFNAR1 antibody–treated (aIFNAR1, 3 weeks' treatment, N = 5) KMC-Miz1fl/fl PDAC. J, Overall survival of KMC-Miz1fl/fl mice treated with (N = 7) or without (N = 12, from F) anti-IFNAR1 blocking antibody. For all panels, ***, P < 0.001; **, P < 0.01; *, P < 0.05.

IFN Signaling to NK and B Cells Is Mediated by CXCL13

Type I IFNs were recently shown to induce expression of the B-cell chemokine CXCL13 (39). RNA-seq analysis showed extremely high expression of Cxcl13 in KMC-Miz1fl/fl tumors, as compared with KMC tumors, which express very little Cxcl13 (Fig. 6A). ISH analysis of KMC-Miz1fl/fl tumors showed Cxcl13 expression was restricted to a subset of F4/80-positive macrophages (Fig. 6B). Notably, only macrophages in close proximity to areas of ductal tumor epithelium stained positive for Ccxl13 mRNA, suggesting paracrine signaling from tumor epithelium to adjacent macrophages. A similar, albeit weaker, pattern of Cxcl13 expression in F4/80-positive macrophages adjacent to ductal epithelium was observed in KMC-Mycfl/fl tumors but was absent from KMC tumors (Fig. 6A; Supplementary Fig. S6E). We used exogenous mouse IFNβ1 treatment of bone marrow–derived macrophages (BMDM) to confirm that IFN can stimulate Cxcl13 expression in macrophages (Fig. 6C). Next, we cultured macrophages with conditioned medium harvested from KMC tumor cells treated with nontargeting or MYC-depleting siRNA and found that only media from MYC-depleted tumor cells could stimulate Cxcl13 expression. Importantly, pretreatment of macrophages with an IFNAR1-blocking antibody completely abrogated Cxcl13 induction (Fig. 6D), confirming that type I IFN released from MYC-depleted tumor cells drives CXCL13 production in macrophages. Antibody-mediated depletion of CXCL13 from KMC-Miz1fl/fl mice suppressed infiltration of both B and NK cells and negated the survival benefit of Miz1 deletion (Fig. 6E–G), whereas isotype control antibody had no effect (Supplementary Fig. S6F). Depletion of NK cells likewise negated the survival benefit, strongly suggesting that they actively restrain the tumor phenotype (Fig. 6H; Supplementary Fig. S6G). Accordingly, coculture of KMC tumor cells with in vitro–activated splenocytes enriched for NK cells showed that KMC tumor cells are efficiently killed by NK cells, equivalent to the established NK target cell line YAC1 (40), in contrast with primary fibroblasts that are largely resistant to NK-mediated killing (Fig. 6I). Taken together, these data delineate a pathway by which KRAS and MYC cooperate to evade NK-mediated antitumor activity in PDAC through suppression of the type I IFN pathway (Fig. 6J).

Figure 6.
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 6.

CXCL13 mediates IFN signaling to B and NK cells in PDAC. A, Normalized RNA-seq reads of Cxcl13 expression in KMC (N = 6) and KMC-Miz1fl/fl (N = 5) pancreatic tumors. B, ISH analysis of Cxcl13-expressing cells in KMC and KMC-Miz1fl/fl tumors. IHC for F4/80 (bottom). Scale bar, 100 μm. C, RT-PCR analysis of Cxcl13 gene expression in BMDMs upon treatment (10 ng/mL for 4 hours) with recombinant mouse IFNβ1. Mean and SEM of technical replicates from 1 of 3 independent experiments. t test; nd, none detected. D, RT-PCR analysis of Cxcl13 gene expression in BMDMs after 24 hours of treatment with conditioned medium from MYC-depleted or control KMC tumor cells. Macrophages were pretreated (20 μg/mL, overnight) with IFNAR1-blocking antibody or isotype control, where indicated. Mean and SEM of technical replicates from 1 of 3 independent experiments. ANOVA and Tukey post hoc test; nd, none detected. E, IHC detection of tumor-infiltrating NK and B cells after 3 weeks of blockade of CXCL13 in KMC-Miz1fl/fl PDAC. Scale bars, 100 μm. F, Quantification of tumor-infiltrating NK (NKp46+) and B (CD45R+) cells in untreated (NT; N = 11 and 10, respectively, from Fig. 5G) and anti-CXCL13–treated (N = 6) KMC-Miz1fl/fl PDAC. Mann–Whitney test. G, Overall survival of KMC-Miz1fl/fl mice treated with (N = 6) or without (N = 12, from Fig. 5F) anti-CXCL13 blocking antibody for 3 weeks. Mantel–Cox log rank test (G and H). H, Overall survival of KMC-Miz1fl/fl mice treated with (N = 6) or without (N = 12, from Fig. 5F) anti-NK1.1 depleting antibody for 4 weeks. I, FACS analysis of Zombie NIR labeling of target cells (KMC, YAC1, and fibroblasts) cocultured with IL2-stimulated, NK cell–enriched splenocytes for 4 hours. Mean and SEM of three independent experiments shown. Two-way ANOVA and Tukey multiple comparisons test. J, Model showing the mechanism of MYC–MIZ1-dependent immune evasion in PDAC. For all panels, ***, P < 0.001; **, P < 0.01; *, P < 0.05; ns, not significant.

Discussion

The evasion of antitumor immunity has emerged in recent years as a major hallmark of cancer that presents genuine therapeutic opportunities through the targeted suppression of immune-evasion mechanisms, often with long-term patient benefit. Most efforts to date have focused on mechanistic evasion of T lymphocyte–mediated tumor immunity, with targeted blockade of CTLA4 and PD-1/PD-L1 establishing a paradigm for successful therapeutic exploitation of immuno-oncology. Here, we present evidence of a mechanism of evasion of innate tumor immunity achieved through cooperation of the frequently dysregulated oncoproteins MYC and KRAS via suppression of the type I IFN pathway.

We identified the type I IFN pathway as a major target of oncogene-mediated suppression through the unbiased analysis of multiple RNA-seq datasets: comparing end-stage pancreatic tumors driven by KRASG12D alone with those driven by the combination of KRASG12D and MYC; comparing KMC-derived tumor cells depleted of Myc, Miz1, or Kras with mock-depleted parental cells; and comparing MEFs upon acute activation of Lsl-KrasG12D, Rosa26DM-lsl-MYC, or both, with WT littermate controls. In all such comparisons, the type I IFN pathway ranked among the pathways most significantly regulated. Although our mechanistic analysis here was performed exclusively in the context of pancreatic cancer, the conservation of this regulation in MEFs suggests that suppression of type I IFNs may be a general feature of cancers wherein MYC and KRAS are dysregulated. For instance, a strong negative correlation between tumors with an IRF8/9 gene signature and those with a MAX gene signature (MAX being the obligate heterodimerizing partner of MYC) was recently reported in mesothelioma (41). Moreover, the type I IFN gene cluster is syntenic with CDKN2A/B on chromosome 9 and is frequently co-deleted with the latter in a spectrum of human cancers: Across multiple cancers, patients with co-deletion show significantly reduced overall survival compared with those who retain the IFN gene cluster, providing further evidence of an antitumor role for this pathway and a selective pressure for cancers to reduce its activity (42).

Mechanistically, we present evidence of repressive MYC–MIZ1 complexes binding to the promoters of STAT1, STAT2, IRF5, and IRF7. These data are complemented by a previous report of MYC–MIZ1 binding to the Stat1 promoter in KPC (KrasG12D;Trp53R172H) murine pancreatic tumor cells (18) and MYC repression of STAT2 in breast cancer cells (43). Recent work has shown that basal expression of many IFN-stimulated genes is regulated by STAT2–IRF9 complexes independently of IFNAR signaling. Upon IFN-dependent activation of IFNAR, signaling through JAK family kinases leads to STAT1 binding to STAT2–IRF9 to form the ISGF3 complex (36), driving expression of, among other genes, IRF7, which in turn is strictly required for IFNα/β production (44). Note that other STAT family members may have very different effects, as recently evidenced by STAT6 driving expression of Myc during PDAC progression in response to Th2-derived ILs (45). MYC–MIZ1 thus attenuates the type I IFN cascade at multiple points that would limit both basal and IFN-stimulated gene expression. The effects of KRAS on this pathway appear to be largely a consequence of MYC stabilization, at least in PDAC cells (25); however, signaling cross-talk between the RAS and JAK–STAT pathways likely contributes to some of the MYC-independent effects observed, or indeed to the stronger effects of KRAS modulation in these systems (46). Similarly, MIZ1 likely has additional roles in PDAC beyond its function as a MYC corepressor, evidenced by divergent regulation of some 40% of MYC-regulated genes upon acute depletion of MIZ1 in KMC cells. The fact that Miz1 could be efficiently deleted in ductal tumor epithelium, unlike endogenous Myc, argues that its role in PDAC is more limited and likely explains the stronger impact of the floxed Miz1 genotype upon Cxcl13 induction in vivo, as compared with the floxed Myc allele.

We demonstrate that derepression of the type I IFN pathway in PDAC tumor cells stimulates production in nearby macrophages of the canonical B-cell chemokine CXCL13, resulting in tumor infiltration by B and NK cells. Although the recruitment of NK cells may well be an indirect consequence of B-cell recruitment, as suggested by recent data (21), evidence is emerging of a direct role for CXCL13 in NK-cell recruitment, and a subset of NK cells express the CXCL13 receptor CXCR5 (47). Depletion of CXCL13 or blockade of the type I IFN receptor IFNAR each suppressed B- and NK-cell infiltration and reversed the survival benefit of Miz1 deletion in KMC tumors. Using coculture experiments, we showed that NK cells can efficiently kill KMC tumor cells, and that their depletion also negated the survival benefit observed upon Miz1 deletion. As is the case with cytotoxic T cells, NK cells express a variety of activating and repressive surface markers that are amenable to extrinsic modulation. As such, targeted activation of NK cells is emerging as an attractive therapeutic option, particularly in tumors with low mutation burden or lack of PD-L1 expression (48).

It would be implausible to suggest that the dramatic acceleration of PDAC development observed upon MYC and KRASG12D coexpression is entirely explained by these effects on the immune landscape. Indeed, these are highly pleiotropic oncoproteins with broad influence over many cell-intrinsic and cell-extrinsic biological features (21, 45). It is notable however that regulation of the type I IFN pathway occurs upon physiologic expression of KRASG12D or upon very modest overexpression of MYC, suggesting that this regulation may be present from the very outset of tumor initiation. This raises the exciting possibility of early intervention to reactivate IFN signaling. Although we show that pharmacologic inhibition of the RAS pathway can restore IFN-related gene expression in vitro, we would caution against such an approach in vivo given that immune cells use the very same RAS pathway to achieve their own rapid expansion (49). What is clear however is that a very modest increase in MYC suffices to dramatically accelerate KRAS-initiated tumors to metastatic PDAC, as we previously reported for lung adenocarcinoma (12), or indeed to alone drive PNET formation. The different etiologies of these phenotypes remain to be fully explored.

Methods

Animal Studies

All experiments involving mice were approved by the local animal welfare committee [Animal Welfare Ethical Review Body (AWERB)] and conducted under U.K. Home Office licenses PE47BC0BF, 70/7950, and 70/8375. Mice were maintained on a constant 12-hour light/dark cycle, fed and watered ad libitum, and all were mixed background (FVBN and C57BL/6). The following genetically modified mice were described previously: Lsl-KrasG12D (5); Rosa26DM-lsl-MYC (23); Pdx1-Cre (6); Pdx1-CreER (29); Mycfl (50); Hprt-Lsl-IRFP (30); and Miz1ΔPOZ (38). All genotyping was performed by Transnetyx Inc. To induce allele recombination, CreERT2 was activated in the pancreas of 5- to 6-week-old mice by intraperitoneal injection of 2 mg/kg tamoxifen (dissolved in peanut oil) for 3 consecutive days. For overall survival analysis, cohorts of mice were monitored and euthanized when clinical endpoint was reached. Endpoint monitoring was performed by facility staff without knowledge of genotype. For histologic analysis, mouse tissues were fixed with 10% neutral buffered formalin overnight. At euthanasia, a small portion of pancreatic tumor was snap-frozen for RNA analysis. To determine the influence of CXCL13, a cohort of randomly selected KMC-Miz1ΔPOZ mice were treated with CXCL13-blocking antibody (0.5 μg, i.v., AF470, R&D Systems) or isotype control (goat IgG, AB-108-C, R&D Systems) from 6 weeks of age, twice weekly for 3 weeks, and sacrificed at clinical endpoint. To determine the influence of IFN signaling, a cohort of randomly selected KMC-Miz1ΔPOZ mice were treated with IFNAR1-blocking antibody (clone MAR1.5A3, BE0241, BioXCell) intraperitoneally, 200 μg/20 g body mass on first dose and 100 μg/20 g for the following six doses, from 6 weeks of age, once every 3 days for 3 weeks, and sacrificed at clinical endpoint. For NK-cell depletion, 6-week-old mice were treated with anti-NK1.1 (clone PK136, BP0036, BioXCell), intraperitoneally, 100 μg/20 g, two doses in the first week and once per week for the following 3 weeks. To verify NK-cell depletion following the NK1.1 antibody treatment, blood was sampled by tail bleed from mice prior to and after 2 weeks of treatment. Cells were stained with CD45 (10311, BioLegend), CD3 (100327, BioLegend), NK1.1 (108707, BioLegend), NKp46 (137612, BioLegend), and Zombie NIR10311, (423106, BioLegend) after red blood cell lysis (eBioscience, 00-4333-57) and analyzed by flow cytometry (BD Fortessa). FACS profiles were generated and quantified using FlowJo (Tree Star). Rosa26DM-lsl-MYC mice are available from JAX Mice at https://www.jax.org/strain/033805.

IHC and Tissue Analysis

All IHC and ISH staining was performed on 4-μm formalin-fixed, paraffin-embedded sections, which had previously been heated to 60°C for 2 hours. Peroxidase blocking was performed for 10 minutes in 1% H2O2 diluted in H2O, followed by heat-mediated or enzyme-mediated antigen retrieval. Nonspecific antibody binding was blocked with up to 3% BSA or up to 5% normal goat serum for 1 hour at room temperature. The following antibodies were used at the indicated dilution and indicated antigen retrieval method: synaptophysin (ab8049, 1:50, pH 6), CD45R (ab64100, 1:200, ER2 Leica), NKp46 (aF2225, 1:200, pH 6), F4/80 (ab6640, 1:100, Enzyme 1 Leica), MYC (ab32072, 1:100, pH 6, Abcam), KRASG12D (CST14429, 1:50, pH 9, Cell Signaling Technology), and pan-cytokeratin (MS-343, 1:100, pH 6, Thermo Fisher Scientific). NKp46, pan-cytokeratin, and synaptophysin were stained on a Dako AutostainerLink48, CD45R and F4/80 were stained on the Leica Bond Rx Autostainer, and KRASG12D and MYC were stained manually. Mouse EnVision (Agilent), and goat ImmPRESS Kit and rabbit IgG (Vector Laboratories) were used as secondary antibodies. The horseradish peroxidase (HRP) signal was detected using liquid DAB (Agilent and Invitrogen). Sections were counterstained with hematoxylin and cover-slipped using DPX mount (CellPath). ISH detection of Cxcl13 (ACD 406318), Miz1 (ACD 520288), and PP1β (ACD 313918; Advanced Cell Diagnostic) mRNA was performed using RNAscope 2.5 LS Detection Kit (ACD). Detection of murine Myc (ACD 712368) was performed using a BaseScope 2.5 LS Detection Kit (ACD). Both techniques were performed on a Leica Bond Rx Autostainer, strictly adhering to ACD protocols. Tumor area was calculated using HALO Software (Indica Labs) as the percent area of pancreas occupied by PDAC and PNET, measured on hematoxylin and eosin–stained sections. To quantify the immune infiltration, positive cells were counted manually using QuPath cell (https://qupath.github.io/) counter function and normalized to tumor area (PDAC + PNET) calculated as described above.

Cell Culture

Human pancreatic cell lines were obtained from ATCC and were maintained in DMEM (MIA PaCa-2) or RPMI (AsPC-1, DAN-G) supplemented with 10% FBS and penicillin–streptomycin. All cell lines were validated using an approved in-house validation service (CRUK-BICR) and tested periodically for Mycoplasma. Cell lines were thawed from primary stocks maintained under liquid nitrogen and cultured for a maximum of 8 weeks (<20 passages), during which time all experiments were performed. Cells were treated with 10 nmol/L (DAN-G) or 50 nmol/L (AsPC-1) trametinib (MedChem Express) for 16 hours and used for protein and RNA analysis. Primary MEFs were generated from E13.5 embryos by interbreeding mice carrying Rosa26DM-lsl-MYC, Lsl-KrasG12D, and Mycfl/fl to obtain desired genotypes. MEFs were cultured in DMEM with 10% FBS and penicillin–streptomycin in 3% oxygen. To activate floxed alleles, MEFs were infected with 300 pfu/cell of Adeno-Cre (University of Iowa, Vector Core Facility, Iowa City, IA) and harvested at 24 hours. Mouse pancreatic tumor lines were generated from end-stage KMC mice. Tumors were disintegrated mechanically and cultured in DMEM supplemented with 20% FBS and penicillin–streptomycin. Once established, KMC cells were maintained in DMEM supplemented with 10% FBS and penicillin–streptomycin. For cell death measurements, cells were trypsinized, quenched with 1% BSA followed by replacement of original supernatant, and centrifuged at 300 × g for 5 minutes; 200 μL of Annexin binding buffer (10 mmol/L HEPES pH 7.40, 140 mmol/L NaCl, 2.5 mmol/L CaCl2) and 2 μL of Annexin V-APC (BioLegend 640920) were added to the pellet and incubated for 15 minutes. Propidium iodide (10 μg/mL) was added immediately prior to FACS analysis. For immunoblotting, whole-cell lysates were prepared in RIPA buffer (150 mmol/L NaCl, 50 mmol/L Tris pH 7.5, 1% NP-40, 0.5% sodium deoxycholic acid, 1% SDS, plus complete protease and phosphatase inhibitor cocktail) followed by sonication (40% Amp for 5 seconds). MYC (ab32072), vinculin (ab129002), Antibodies to histone H2B (ab1790, Abcam), pERK1/2 (CST 4370), ERK1/2 (CST 4695, Cell Signaling Technology), and Actin (SC 47778, Santa Cruz Biotechnology) were used as primary antibodies. Secondary HRP-conjugated antibodies (α-mouse IgG NA931V and α-rabbit IgG NA934V, both GE Healthcare; and α-goat IgG, Vector Laboratories PI-9500) were detected by chemiluminescence (Bio-Rad Western blotting substrate 1705060). To deplete MYC in human pancreatic cell lines, the following siRNAs were used: siMYC 5 (Qiagen SI00300902) and siMYC 9 (SI03101847). To deplete MYC in mouse pancreatic tumor lines, a combination of mouse and human siRNA was used as follows: Pool 1 (SI01321012 and SI00300902), Pool 2 (SI01321012 and SI03101847), Pool 3 (SI01320991 and SI00300902; all from Qiagen). To deplete Miz1 in mouse lines, SI01320991 (Qiagen) was used. To deplete Kras in mouse lines, SI02742439 (Qiagen) was used.

BMDM

Bone marrow cells were isolated from WT mice by snipping the end of the femur and centrifuging at 5,000 rpm for 1 minute. Monocytes were differentiated into macrophages by culturing in non–TC-treated plates (Corning, 430597) for 6 days in RPMI medium containing M-CSF (10 ng/mL). Medium containing M-CSF was replaced after 3 days. Where indicated, BMDMs were treated with recombinant mouse IFNβ1 (8234-MB, R&D Systems) for 4 hours (10 ng/mL). KMC tumor cells were used to generate conditioned medium. Fresh medium (DMEM + 20%FBS) were added 24 hours after transfection with siMYC or nontargeting control siRNA. Twenty-four hours later, conditioned medium from MYC or nontargeting control–depleted cells was collected, centrifuged (1,200 rpm, 5 minutes), and supplemented with M-CSF and, where indicated, anti-IFNAR1–blocking antibody (20 ng/mL, BE0241, BioXCell) or mIgG (BE0083) prior to BMDM treatment. BMDMs were additionally pretreated with anti-IFNAR1 or mIgG overnight. BMDMs were treated with conditioned medium for 24 hours. To detect Cxcl13 expression in BMDMs, cDNA was synthesized with Oligo-dT primer (M510, Promega), and preamplified (40 nmol/L of each primer, SYBR Green buffer, 1 mg/mL BSA, 2.5% glycerol) for GusB and Cxcl13 for 20 cycles. Diluted cDNA (1:20 in 10 mmol/L Tris and 1 mmol/L EDTA) was quantified by real-time PCR using SYBR Green method (VWR QUNT95072).

In Vitro Cytotoxicity Assay

NK cells were activated ex vivo as described previously (51): Freshly isolated splenocytes of naïve mice at 3 × 106 cells/mL were treated for 72 hours with 50 ng/mL of IL2 (BioLegend, catalog number 575404). Target cells, stained with a cell trace dye (Thermo Fisher Scientific, catalog number C34567 or V12883) following the manufacturer's instructions, were cocultured with different ratios (0, 5, and 10) of IL2-stimulated splenocytes, enriched for activated NK cells. After 4-hour coincubation, cells were harvested, stained with Zombie NIR (BioLegend, catalog number 423106), and analyzed by flow cytometry (BD Fortessa). FlowJo (Tree Star) software was used for analysis.

ChIP

Dan-G cells were cross-linked with formaldehyde (1% final concentration) for 10 minutes at 37°C. Cells were scraped in PBS containing protease inhibitors and centrifuged at 300 × g for 5 minutes (4°C). Cells were resuspended in lysis buffer 1 (5 mmol/L PIPES pH 8, 85 mmol/L KCl, 0.5% NP40) and incubated on ice for 20 minutes. After lysis, cells were centrifuged at 300 × g for 5 minutes (4°C) and the pellets were resuspended in lysis buffer II (RIPA). After 10-minute incubation, lysates were sonicated to fragment DNA. Chromatin was precleared and immunoprecipitated with 5 μg of MYC (N262, SC764) or MIZ1 (B10, SC136985) antibody overnight at 4°C followed by incubation with 60 μL of Protein G beads (17-0618-01, GE Healthcare). Rabbit IgG (CS2729) or mouse IgG (BE0083) was used as antibody control. DNA was then eluted using elution buffer (1% SDS, 0.1 mol/L NaHCO3), de–cross-linked and purified using Qiagen PCR Purification Kit for q-PCR analysis. For Re-ChIP, α-MYC or RIgG control immunoprecipitated chromatin was eluted with Re-ChIP elution buffer (1× TE, 2% SDS, 15 mmol/L DTT) at 37°C for 30 minutes, immunoprecipitated with 5 μg of MIZ1 (B10, Sc136985) antibody overnight at 4°C. The immunoprecipitated DNA was eluted as described above. The following primer sets were used: IRF7 promoter: gacaccagcctgaccaacatag, acaatcttggcccaccacaac; IRF5 promoter: aagagcaagagttaccaagcga, taaagaacctcaccccagaacc; IRF5 intronic region: ctctggctttctcctgcagacc, cccattgaagccctgggtact; STAT1 promoter: gctggtcgtcactctcacaa, tcgcctactcttaaggggct; STAT2 promoter: tccaggctcctcaagctagt, gcactttctacgaggggagg; and VAMP4 promoter: cagtggttgttcctcccta, ccgagccctattcacctaaa.

RNA-seq Analysis

Ribosome-depleted total RNA was used for analysis of MEF gene expression. Poly-A enriched RNA was analyzed for bulk tumor and KMC cell line gene expression. Datasets are available from ArrayExpress under accession numbers E-MTAB 6824 (MEFs); E-MTAB 8792 (KMC cell lines), and E-MTAB 8797 (PDAC tumors). Full details of next-generation sequencing protocols and downstream analysis are provided in the Supplementary Materials and Methods.

Statistical Analysis

Raw data obtained from qRT-PCR, FACS, and growth curves were copied into Excel (Microsoft) or GraphPad prism spreadsheets. All mean and SEM values of biological replicates were calculated using the calculator function. Graphical representation of such data was produced in Excel or GraphPad Prism. Statistical significance was determined by the Student t test. For multiple comparisons, ANOVA was used with a post hoc Turkey test or post hoc Fischer LSD test. For non–normally distributed data (e.g., survival benefit and immune cell infiltration), Mantel–Cox (two-way comparison), or Kruskal–Wallis (multiple comparison) tests were performed. For RNA-seq data, adjusted P values calculated in R are shown. *, P < 0.05; **, P < 0.01; ***, P < 0.005.

Disclosure of Potential Conflicts of Interest

O.J. Sansom reports receiving commercial research grants from AstraZeneca, Novartis, and Cancer Research Technology. D.J. Murphy reports receiving commercial research grants from Puma Biotechnology and Merck Pharmaceutical Group. No potential conflicts of interest were disclosed by the other authors.

Authors' Contributions

Conception and design: N. Muthalagu, S.B. Coffelt, O.J. Sansom, D.J. Murphy

Development of methodology: N. Muthalagu, R. Wiesheu, S. Neidler, S.B. Coffelt, O.J. Sansom

Acquisition of data (provided animals, acquired and managed patients, provided facilities, etc.): N. Muthalagu, T. Monteverde, X. Raffo-Iraolagoitia, R. Wiesheu, D. Whyte, S. Laing, B. Kruspig, S.A. Karim, K. Gyuraszova, L.M. Carlin, J.P. Morton

Analysis and interpretation of data (e.g., statistical analysis, biostatistics, computational analysis): N. Muthalagu, X. Raffo-Iraolagoitia, R. Wiesheu, D. Whyte, A. Hedley, R. Upstill-Goddard, R. Shaw, C. Rink, A.V. Biankin, S.B. Coffelt, J.P. Morton, D.J. Murphy

Writing, review, and/or revision of the manuscript: N. Muthalagu, T. Monteverde, A. Hedley, R. Shaw, C. Nixon, A.V. Biankin, S.B. Coffelt, O.J. Sansom, J.P. Morton, D.J. Murphy

Administrative, technical, or material support (i.e., reporting or organizing data, constructing databases): C. Nixon, W. Clark, S.B. Coffelt

Study supervision: N. Muthalagu, S.B. Coffelt, O.J. Sansom, J.P. Morton, D.J. Murphy

Other (supervised the work on this paper of one of the co-authors): L.M. Carlin

Acknowledgments

The authors thank all members of the Murphy Lab past and present who contributed to the development of this work. We would like to thank the core services at the CRUK Beatson Institute with particular thanks to the Biological Services Unit and histology core facility. Thanks to Kirsteen Campbell, Florian Bock, and the Stephen Tait laboratories for helpful discussions and to Catherine Winchester for critical reading of the manuscript. Artwork was provided by Sara Zanivan using images from https://smart.servier.com/. Miz1ΔPOZ mice were provided by Martin Eilers. Funding for this work was provided by Worldwide Cancer Research grant AICR 15-0279; Pancreatic Cancer UK Future Leaders Academy 2017; European Commission Marie-Curie actions PCIG13-GA-2013-618448, SERPLUC, and H2020-MCSA-IF-2015-705190-NuSiCC; and Cancer Research UK grants A21139 (to O.J. Sansom) and A23983 (to L.M. Carlin). N. Muthalagu received a L'Oreal/UNESCO Women in Science 2018 award. T. Monteverde was funded through a British Lung Foundation studentship (BLF-APHD13-5). Additional support was provided by Wellcome Trust grant 105614/Z/14/Z; CRUK Glasgow Cancer Centre grant A25142; and CRUK Beatson Institute core facilities grant A17196.

Footnotes

  • Note: Supplementary data for this article are available at Cancer Discovery Online (http://cancerdiscovery.aacrjournals.org/).

  • Cancer Discov 2020;10:872–87

  • Received May 30, 2019.
  • Revision received February 7, 2020.
  • Accepted March 18, 2020.
  • Published first March 21, 2020.
  • ©2020 American Association for Cancer Research.

References

  1. 1.↵
    1. Rahib L,
    2. Smith BD,
    3. Aizenberg R,
    4. Rosenzweig AB,
    5. Fleshman JM,
    6. Matrisian LM
    . Projecting cancer incidence and deaths to 2030: the unexpected burden of thyroid, liver, and pancreas cancers in the United States. Cancer Res 2014;74:2913–21.
    OpenUrlAbstract/FREE Full Text
  2. 2.↵
    1. Neoptolemos JP,
    2. Kleeff J,
    3. Michl P,
    4. Costello E,
    5. Greenhalf W,
    6. Palmer DH
    . Therapeutic developments in pancreatic cancer: current and future perspectives. Nat Rev Gastroenterol Hepatol 2018;15:333–48.
    OpenUrlCrossRefPubMed
  3. 3.↵
    1. Bailey P,
    2. Chang DK,
    3. Nones K,
    4. Johns AL,
    5. Patch AM,
    6. Gingras MC,
    7. et al.
    Genomic analyses identify molecular subtypes of pancreatic cancer. Nature 2016;531:47–52.
    OpenUrlCrossRefPubMed
  4. 4.↵
    Cancer Genome Atlas Research Network. Integrated genomic characterization of pancreatic ductal adenocarcinoma. Cancer Cell 2017;32:185–203.
    OpenUrlCrossRefPubMed
  5. 5.↵
    1. Jackson EL,
    2. Willis N,
    3. Mercer K,
    4. Bronson RT,
    5. Crowley D,
    6. Montoya R,
    7. et al.
    Analysis of lung tumor initiation and progression using conditional expression of oncogenic K-ras. Genes Dev 2001;15:3243–8.
    OpenUrlAbstract/FREE Full Text
  6. 6.↵
    1. Hingorani SR,
    2. Petricoin EF,
    3. Maitra A,
    4. Rajapakse V,
    5. King C,
    6. Jacobetz MA,
    7. et al.
    Preinvasive and invasive ductal pancreatic cancer and its early detection in the mouse. Cancer Cell 2003;4:437–50.
    OpenUrlCrossRefPubMed
  7. 7.↵
    1. Aguirre AJ,
    2. Bardeesy N,
    3. Sinha M,
    4. Lopez L,
    5. Tuveson DA,
    6. Horner J,
    7. et al.
    Activated Kras and Ink4a/Arf deficiency cooperate to produce metastatic pancreatic ductal adenocarcinoma. Genes Dev 2003;17:3112–26.
    OpenUrlAbstract/FREE Full Text
  8. 8.↵
    1. Morton JP,
    2. Timpson P,
    3. Karim SA,
    4. Ridgway RA,
    5. Athineos D,
    6. Doyle B,
    7. et al.
    Mutant p53 drives metastasis and overcomes growth arrest/senescence in pancreatic cancer. Proc Natl Acad Sci U S A 2010;107:246–51.
    OpenUrlAbstract/FREE Full Text
  9. 9.↵
    1. Mueller S,
    2. Engleitner T,
    3. Maresch R,
    4. Zukowska M,
    5. Lange S,
    6. Kaltenbacher T,
    7. et al.
    Evolutionary routes and KRAS dosage define pancreatic cancer phenotypes. Nature 2018;554:62–8.
    OpenUrlCrossRefPubMed
  10. 10.↵
    1. Cicchini M,
    2. Buza EL,
    3. Sagal KM,
    4. Gudiel AA,
    5. Durham AC,
    6. Feldser DM
    . Context-dependent effects of amplified MAPK signaling during lung adenocarcinoma initiation and progression. Cell Rep 2017;18:1958–69.
    OpenUrl
  11. 11.↵
    1. Kerr EM,
    2. Gaude E,
    3. Turrell FK,
    4. Frezza C,
    5. Martins CP
    . Mutant Kras copy number defines metabolic reprogramming and therapeutic susceptibilities. Nature 2016;531:110–3.
    OpenUrlCrossRefPubMed
  12. 12.↵
    1. Kruspig B,
    2. Monteverde T,
    3. Neidler S,
    4. Hock A,
    5. Kerr E,
    6. Nixon C,
    7. et al.
    The ERBB network facilitates KRAS-driven lung tumorigenesis. Sci Transl Med 2018;10: pii:eaao2565.
  13. 13.↵
    1. Moll HP,
    2. Pranz K,
    3. Musteanu M,
    4. Grabner B,
    5. Hruschka N,
    6. Mohrherr J,
    7. et al.
    Afatinib restrains K-RAS-driven lung tumorigenesis. Sci Transl Med 2018;10: pii:eaao2301.
  14. 14.↵
    1. Kapoor A,
    2. Yao W,
    3. Ying H,
    4. Hua S,
    5. Liewen A,
    6. Wang Q,
    7. et al.
    Yap1 activation enables bypass of oncogenic Kras addiction in pancreatic cancer. Cell 2014;158:185–97.
    OpenUrlCrossRefPubMed
  15. 15.↵
    1. Wirth M,
    2. Schneider G
    . MYC: a stratification marker for pancreatic cancer therapy. Trends Cancer 2016;2:1–3.
    OpenUrl
  16. 16.↵
    1. Schleger C,
    2. Verbeke C,
    3. Hildenbrand R,
    4. Zentgraf H,
    5. Bleyl U
    . c-MYC activation in primary and metastatic ductal adenocarcinoma of the pancreas: incidence, mechanisms, and clinical significance. Mod Pathol 2002;15:462–9.
    OpenUrlCrossRefPubMed
  17. 17.↵
    1. Farrell AS,
    2. Joly MM,
    3. Allen-Petersen BL,
    4. Worth PJ,
    5. Lanciault C,
    6. Sauer D,
    7. et al.
    MYC regulates ductal-neuroendocrine lineage plasticity in pancreatic ductal adenocarcinoma associated with poor outcome and chemoresistance. Nat Commun 2017;8:1728.
    OpenUrlCrossRefPubMed
  18. 18.↵
    1. Walz S,
    2. Lorenzin F,
    3. Morton J,
    4. Wiese KE,
    5. von Eyss B,
    6. Herold S,
    7. et al.
    Activation and repression by oncogenic MYC shape tumour-specific gene expression profiles. Nature 2014;511:483–7.
    OpenUrlCrossRefPubMed
  19. 19.↵
    1. Saborowski M,
    2. Saborowski A,
    3. Morris JPt,
    4. Bosbach B,
    5. Dow LE,
    6. Pelletier J,
    7. et al.
    A modular and flexible ESC-based mouse model of pancreatic cancer. Genes Dev 2014;28:85–97.
    OpenUrlAbstract/FREE Full Text
  20. 20.↵
    1. Hayes TK,
    2. Neel NF,
    3. Hu C,
    4. Gautam P,
    5. Chenard M,
    6. Long B,
    7. et al.
    Long-term ERK inhibition in KRAS-mutant pancreatic cancer is associated with MYC degradation and senescence-like growth suppression. Cancer Cell 2016;29:75–89.
    OpenUrlCrossRefPubMed
  21. 21.↵
    1. Sodir NM,
    2. Kortlever RM,
    3. Barthet VJA,
    4. Campos T,
    5. Pellegrinet L,
    6. Kupczak S,
    7. et al.
    Myc instructs and maintains pancreatic adenocarcinoma phenotype. Cancer Discov 2020;10:588–607 .
    OpenUrlAbstract/FREE Full Text
  22. 22.↵
    1. Herold S,
    2. Wanzel M,
    3. Beuger V,
    4. Frohme C,
    5. Beul D,
    6. Hillukkala T,
    7. et al.
    Negative regulation of the mammalian UV response by Myc through association with Miz-1. Mol Cell 2002;10:509–21.
    OpenUrlCrossRefPubMed
  23. 23.↵
    1. Neidler S,
    2. Kruspig B,
    3. Hewit K,
    4. Monteverde T,
    5. Gyuraszova K,
    6. Braun A,
    7. et al.
    Identification of a clinically relevant signature for early progression in KRAS-driven lung adenocarcinoma. Cancers 2019;11: pii:E600.
  24. 24.↵
    1. Facchini LM,
    2. Chen S,
    3. Marhin WW,
    4. Lear JN,
    5. Penn LZ
    . The Myc negative autoregulation mechanism requires Myc-Max association and involves the c-myc P2 minimal promoter. Mol Cell Biol 1997;17:100–14.
    OpenUrlAbstract/FREE Full Text
  25. 25.↵
    1. Vaseva AV,
    2. Blake DR,
    3. Gilbert TSK,
    4. Ng S,
    5. Hostetter G,
    6. Azam SH,
    7. et al.
    KRAS suppression-induced degradation of MYC is antagonized by a MEK5-ERK5 compensatory mechanism. Cancer Cell 2018;34:807–22.
    OpenUrlCrossRefPubMed
  26. 26.↵
    1. Santana-Codina N,
    2. Roeth AA,
    3. Zhang Y,
    4. Yang A,
    5. Mashadova O,
    6. Asara JM,
    7. et al.
    Oncogenic KRAS supports pancreatic cancer through regulation of nucleotide synthesis. Nat Commun 2018;9:4945.
    OpenUrl
  27. 27.↵
    1. Lenoir WF,
    2. Lim TL,
    3. Hart T
    . PICKLES: the database of pooled in vitro CRISPR knockout library essentiality screens. Nucleic Acids Res 2018;46:D776–D80.
    OpenUrlCrossRef
  28. 28.↵
    1. Wilson ME,
    2. Scheel D,
    3. German MS
    . Gene expression cascades in pancreatic development. Mech Dev 2003;120:65–80.
    OpenUrlCrossRefPubMed
  29. 29.↵
    1. Gu G,
    2. Dubauskaite J,
    3. Melton DA
    . Direct evidence for the pancreatic lineage: NGN3+ cells are islet progenitors and are distinct from duct progenitors. Development 2002;129:2447–57.
    OpenUrlPubMed
  30. 30.↵
    1. Hock AK,
    2. Cheung EC,
    3. Humpton TJ,
    4. Monteverde T,
    5. Paulus-Hock V,
    6. Lee P,
    7. et al.
    Development of an inducible mouse model of iRFP713 to track recombinase activity and tumour development in vivo. Sci Rep 2017;7:1837.
    OpenUrl
  31. 31.↵
    1. Murphy DJ,
    2. Junttila MR,
    3. Pouyet L,
    4. Karnezis A,
    5. Shchors K,
    6. Bui DA,
    7. et al.
    Distinct thresholds govern Myc's biological output in vivo. Cancer Cell 2008;14:447–57.
    OpenUrlCrossRefPubMed
  32. 32.↵
    1. Sears R,
    2. Nuckolls F,
    3. Haura E,
    4. Taya Y,
    5. Tamai K,
    6. Nevins JR
    . Multiple Ras-dependent phosphorylation pathways regulate Myc protein stability. Genes Dev 2000;14:2501–14.
    OpenUrlAbstract/FREE Full Text
  33. 33.↵
    1. Ram DR,
    2. Manickam C,
    3. Hueber B,
    4. Itell HL,
    5. Permar SR,
    6. Varner V,
    7. et al.
    Tracking KLRC2 (NKG2C)+ memory-like NK cells in SIV+ and rhCMV+ rhesus macaques. PLoS Pathog 2018;14:e1007104.
    OpenUrlCrossRef
  34. 34.↵
    1. Kortlever RM,
    2. Sodir NM,
    3. Wilson CH,
    4. Burkhart DL,
    5. Pellegrinet L,
    6. Brown Swigart L,
    7. et al.
    Myc cooperates with Ras by programming inflammation and immune suppression. Cell 2017;171:1301–15.
    OpenUrlCrossRefPubMed
  35. 35.↵
    1. Oppmann B,
    2. Lesley R,
    3. Blom B,
    4. Timans JC,
    5. Xu Y,
    6. Hunte B,
    7. et al.
    Novel p19 protein engages IL-12p40 to form a cytokine, IL-23, with biological activities similar as well as distinct from IL-12. Immunity 2000;13:715–25.
    OpenUrlCrossRefPubMed
  36. 36.↵
    1. Platanitis E,
    2. Demiroz D,
    3. Schneller A,
    4. Fischer K,
    5. Capelle C,
    6. Hartl M,
    7. et al.
    A molecular switch from STAT2-IRF9 to ISGF3 underlies interferon-induced gene transcription. Nat Commun 2019;10:2921.
    OpenUrl
  37. 37.↵
    1. Lorenzin F,
    2. Benary U,
    3. Baluapuri A,
    4. Walz S,
    5. Jung LA,
    6. von Eyss B,
    7. et al.
    Different promoter affinities account for specificity in MYC-dependent gene regulation. Elife 2016;5: pii:e15161.
  38. 38.↵
    1. Kosan C,
    2. Saba I,
    3. Godmann M,
    4. Herold S,
    5. Herkert B,
    6. Eilers M,
    7. et al.
    Transcription factor miz-1 is required to regulate interleukin-7 receptor signaling at early commitment stages of B cell differentiation. Immunity 2010;33:917–28.
    OpenUrlCrossRefPubMed
  39. 39.↵
    1. Denton AE,
    2. Innocentin S,
    3. Carr EJ,
    4. Bradford BM,
    5. Lafouresse F,
    6. Mabbott NA,
    7. et al.
    Type I interferon induces CXCL13 to support ectopic germinal center formation. J Exp Med 2019;216:621–37.
    OpenUrlAbstract/FREE Full Text
  40. 40.↵
    1. Nieswandt B,
    2. Hafner M,
    3. Echtenacher B,
    4. Mannel DN
    . Lysis of tumor cells by natural killer cells in mice is impeded by platelets. Cancer Res 1999;59:1295–300.
    OpenUrlAbstract/FREE Full Text
  41. 41.↵
    1. Hmeljak J,
    2. Sanchez-Vega F,
    3. Hoadley KA,
    4. Shih J,
    5. Stewart C,
    6. Heiman D,
    7. et al.
    Integrative molecular characterization of malignant pleural mesothelioma. Cancer Discov 2018;8:1548–65.
    OpenUrlAbstract/FREE Full Text
  42. 42.↵
    1. Ye Z,
    2. Dong H,
    3. Li Y,
    4. Ma T,
    5. Huang H,
    6. Leong HS,
    7. et al.
    Prevalent homozygous deletions of type i interferon and defensin genes in human cancers associate with immunotherapy resistance. Clin Cancer Res 2018;24:3299–308.
    OpenUrlAbstract/FREE Full Text
  43. 43.↵
    1. Qiao X,
    2. Liu Y,
    3. Llamazares Prada M,
    4. Mohan AK,
    5. Gupta A,
    6. Jaiswal A,
    7. et al.
    UBR5 is co-amplified with MYC in breast tumors and encodes an ubiquitin ligase that limits MYC-dependent apoptosis. Cancer Res 2020;80:1414–27 .
    OpenUrlAbstract/FREE Full Text
  44. 44.↵
    1. Honda K,
    2. Yanai H,
    3. Negishi H,
    4. Asagiri M,
    5. Sato M,
    6. Mizutani T,
    7. et al.
    IRF-7 is the master regulator of type-I interferon-dependent immune responses. Nature 2005;434:772–7.
    OpenUrlCrossRefPubMed
  45. 45.↵
    1. Dey P,
    2. Li J,
    3. Zhang J,
    4. Chaurasiya S,
    5. Strom A,
    6. Wang H,
    7. et al.
    Oncogenic Kras driven metabolic reprogramming in pancreas cancer cells utilizes cytokines from the tumor microenvironment. Cancer Discov 2020;10:608–25 .
    OpenUrlAbstract/FREE Full Text
  46. 46.↵
    1. Thomas SJ,
    2. Snowden JA,
    3. Zeidler MP,
    4. Danson SJ
    . The role of JAK/STAT signalling in the pathogenesis, prognosis and treatment of solid tumours. Br J Cancer 2015;113:365–71.
    OpenUrlCrossRefPubMed
  47. 47.↵
    1. Yang CL,
    2. Zhang P,
    3. Liu RT,
    4. Zhang N,
    5. Zhang M,
    6. Li H,
    7. et al.
    CXCR5-negative natural killer cells ameliorate experimental autoimmune myasthenia gravis by suppressing follicular helper T cells. J Neuroinflammation 2019;16:282.
    OpenUrl
  48. 48.↵
    1. Chiossone L,
    2. Dumas PY,
    3. Vienne M,
    4. Vivier E
    . Natural killer cells and other innate lymphoid cells in cancer. Nat Rev Immunol 2018;18:671–88.
    OpenUrlCrossRefPubMed
  49. 49.↵
    1. Berridge MJ
    . Lymphocyte activation in health and disease. Crit Rev Immunol 2017;37:439–62.
    OpenUrlCrossRef
  50. 50.↵
    1. de Alboran IM,
    2. O'Hagan RC,
    3. Gartner F,
    4. Malynn B,
    5. Davidson L,
    6. Rickert R,
    7. et al.
    Analysis of C-MYC function in normal cells via conditional gene-targeted mutation. Immunity 2001;14:45–55.
    OpenUrlCrossRefPubMed
  51. 51.↵
    1. Lafreniere R,
    2. Rosenberg SA
    . Successful immunotherapy of murine experimental hepatic metastases with lymphokine-activated killer cells and recombinant interleukin 2. Cancer Res 1985;45:3735–41.
    OpenUrlAbstract/FREE Full Text
PreviousNext
Back to top
Cancer Discovery: 10 (6)
June 2020
Volume 10, Issue 6
  • Table of Contents
  • Table of Contents (PDF)
  • About the Cover
  • Editorial Board (PDF)

Sign up for alerts

View this article with LENS

Open full page PDF
Article Alerts
Sign In to Email Alerts with your Email Address
Email Article

Thank you for sharing this Cancer Discovery article.

NOTE: We request your email address only to inform the recipient that it was you who recommended this article, and that it is not junk mail. We do not retain these email addresses.

Enter multiple addresses on separate lines or separate them with commas.
Repression of the Type I Interferon Pathway Underlies MYC- and KRAS-Dependent Evasion of NK and B Cells in Pancreatic Ductal Adenocarcinoma
(Your Name) has forwarded a page to you from Cancer Discovery
(Your Name) thought you would be interested in this article in Cancer Discovery.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.
Citation Tools
Repression of the Type I Interferon Pathway Underlies MYC- and KRAS-Dependent Evasion of NK and B Cells in Pancreatic Ductal Adenocarcinoma
Nathiya Muthalagu, Tiziana Monteverde, Ximena Raffo-Iraolagoitia, Robert Wiesheu, Declan Whyte, Ann Hedley, Sarah Laing, Björn Kruspig, Rosanna Upstill-Goddard, Robin Shaw, Sarah Neidler, Curtis Rink, Saadia A. Karim, Katarina Gyuraszova, Colin Nixon, William Clark, Andrew V. Biankin, Leo M. Carlin, Seth B. Coffelt, Owen J. Sansom, Jennifer P. Morton and Daniel J. Murphy
Cancer Discov June 1 2020 (10) (6) 872-887; DOI: 10.1158/2159-8290.CD-19-0620

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Share
Repression of the Type I Interferon Pathway Underlies MYC- and KRAS-Dependent Evasion of NK and B Cells in Pancreatic Ductal Adenocarcinoma
Nathiya Muthalagu, Tiziana Monteverde, Ximena Raffo-Iraolagoitia, Robert Wiesheu, Declan Whyte, Ann Hedley, Sarah Laing, Björn Kruspig, Rosanna Upstill-Goddard, Robin Shaw, Sarah Neidler, Curtis Rink, Saadia A. Karim, Katarina Gyuraszova, Colin Nixon, William Clark, Andrew V. Biankin, Leo M. Carlin, Seth B. Coffelt, Owen J. Sansom, Jennifer P. Morton and Daniel J. Murphy
Cancer Discov June 1 2020 (10) (6) 872-887; DOI: 10.1158/2159-8290.CD-19-0620
del.icio.us logo Digg logo Reddit logo Twitter logo CiteULike logo Facebook logo Google logo Mendeley logo
  • Tweet Widget
  • Facebook Like
  • Google Plus One

Jump to section

  • Article
    • Abstract
    • Introduction
    • Results
    • Discussion
    • Methods
    • Disclosure of Potential Conflicts of Interest
    • Authors' Contributions
    • Acknowledgments
    • Footnotes
    • References
  • Figures & Data
  • Info & Metrics
  • PDF
Advertisement

Related Articles

Cited By...

More in this TOC Section

  • Glioblastoma Homeostasis Revealed by Synthetic Genetic Tracing
  • Cell of Origin Affects PDAC Subtype
  • Poor Survival and Genetic Features of Black Patients with AML
Show more Research Articles
  • Home
  • Alerts
  • Feedback
  • Privacy Policy
Facebook   Twitter   LinkedIn   YouTube   RSS

Articles

  • OnlineFirst
  • Current Issue
  • Past Issues

Info For

  • Authors
  • Subscribers
  • Advertisers
  • Librarians

About Cancer Discovery

  • About the Journal
  • Editors
  • Journal Sections
  • Permissions
  • Submit a Manuscript
AACR logo

Copyright © 2021 by the American Association for Cancer Research.

Cancer Discovery
eISSN: 2159-8290
ISSN: 2159-8274

Advertisement