Skip to main content
  • AACR Publications
    • Blood Cancer Discovery
    • Cancer Discovery
    • Cancer Epidemiology, Biomarkers & Prevention
    • Cancer Immunology Research
    • Cancer Prevention Research
    • Cancer Research
    • Clinical Cancer Research
    • Molecular Cancer Research
    • Molecular Cancer Therapeutics

AACR logo

  • Register
  • Log in
  • Log out
  • My Cart
Advertisement

Main menu

  • Home
  • About
    • The Journal
    • AACR Journals
    • Journal Sections
    • Subscriptions
    • Reviewing
    • Permissions and Reprints
  • Articles
    • OnlineFirst
    • Current Issue
    • Past Issues
    • Collections
      • COVID-19 & Cancer Resource Center
      • Clinical Trials
      • Immuno-oncology
      • Editors' Picks
      • "Best of" Collection
  • For Authors
    • Information for Authors
    • Author Services
    • Best of: Author Profiles
    • Submit
  • Alerts
    • Table of Contents
    • Editors' Picks
    • OnlineFirst
    • Citation
    • Author/Keyword
    • RSS Feeds
    • My Alert Summary & Preferences
  • News
    • Cancer Discovery News
    • Journal Press Releases
  • COVID-19
  • Webinars
  • 10th Anniversary
  • Search More

    Advanced Search

  • AACR Publications
    • Blood Cancer Discovery
    • Cancer Discovery
    • Cancer Epidemiology, Biomarkers & Prevention
    • Cancer Immunology Research
    • Cancer Prevention Research
    • Cancer Research
    • Clinical Cancer Research
    • Molecular Cancer Research
    • Molecular Cancer Therapeutics

User menu

  • Register
  • Log in
  • Log out
  • My Cart

Search

  • Advanced search
Cancer Discovery
Cancer Discovery
  • Home
  • About
    • The Journal
    • AACR Journals
    • Journal Sections
    • Subscriptions
    • Reviewing
    • Permissions and Reprints
  • Articles
    • OnlineFirst
    • Current Issue
    • Past Issues
    • Collections
      • COVID-19 & Cancer Resource Center
      • Clinical Trials
      • Immuno-oncology
      • Editors' Picks
      • "Best of" Collection
  • For Authors
    • Information for Authors
    • Author Services
    • Best of: Author Profiles
    • Submit
  • Alerts
    • Table of Contents
    • Editors' Picks
    • OnlineFirst
    • Citation
    • Author/Keyword
    • RSS Feeds
    • My Alert Summary & Preferences
  • News
    • Cancer Discovery News
    • Journal Press Releases
  • COVID-19
  • Webinars
  • 10th Anniversary
  • Search More

    Advanced Search

Research Articles

A Genome-Scale RNA Interference Screen Implicates NF1 Loss in Resistance to RAF Inhibition

Steven R. Whittaker, Jean-Philippe Theurillat, Eliezer Van Allen, Nikhil Wagle, Jessica Hsiao, Glenn S. Cowley, Dirk Schadendorf, David E. Root and Levi A. Garraway
Steven R. Whittaker
1Department of Medical Oncology and 2Center for Cancer Genome Discovery, Dana-Farber Cancer Institute; and 3Department of Medicine, Brigham and Women's Hospital, Harvard Medical School, Boston; 4The Broad Institute, Cambridge, Massachusetts; and 5Department of Dermatology, University of Essen, Essen, Germany
1Department of Medical Oncology and 2Center for Cancer Genome Discovery, Dana-Farber Cancer Institute; and 3Department of Medicine, Brigham and Women's Hospital, Harvard Medical School, Boston; 4The Broad Institute, Cambridge, Massachusetts; and 5Department of Dermatology, University of Essen, Essen, Germany
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Jean-Philippe Theurillat
1Department of Medical Oncology and 2Center for Cancer Genome Discovery, Dana-Farber Cancer Institute; and 3Department of Medicine, Brigham and Women's Hospital, Harvard Medical School, Boston; 4The Broad Institute, Cambridge, Massachusetts; and 5Department of Dermatology, University of Essen, Essen, Germany
1Department of Medical Oncology and 2Center for Cancer Genome Discovery, Dana-Farber Cancer Institute; and 3Department of Medicine, Brigham and Women's Hospital, Harvard Medical School, Boston; 4The Broad Institute, Cambridge, Massachusetts; and 5Department of Dermatology, University of Essen, Essen, Germany
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Eliezer Van Allen
1Department of Medical Oncology and 2Center for Cancer Genome Discovery, Dana-Farber Cancer Institute; and 3Department of Medicine, Brigham and Women's Hospital, Harvard Medical School, Boston; 4The Broad Institute, Cambridge, Massachusetts; and 5Department of Dermatology, University of Essen, Essen, Germany
1Department of Medical Oncology and 2Center for Cancer Genome Discovery, Dana-Farber Cancer Institute; and 3Department of Medicine, Brigham and Women's Hospital, Harvard Medical School, Boston; 4The Broad Institute, Cambridge, Massachusetts; and 5Department of Dermatology, University of Essen, Essen, Germany
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Nikhil Wagle
1Department of Medical Oncology and 2Center for Cancer Genome Discovery, Dana-Farber Cancer Institute; and 3Department of Medicine, Brigham and Women's Hospital, Harvard Medical School, Boston; 4The Broad Institute, Cambridge, Massachusetts; and 5Department of Dermatology, University of Essen, Essen, Germany
1Department of Medical Oncology and 2Center for Cancer Genome Discovery, Dana-Farber Cancer Institute; and 3Department of Medicine, Brigham and Women's Hospital, Harvard Medical School, Boston; 4The Broad Institute, Cambridge, Massachusetts; and 5Department of Dermatology, University of Essen, Essen, Germany
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Jessica Hsiao
1Department of Medical Oncology and 2Center for Cancer Genome Discovery, Dana-Farber Cancer Institute; and 3Department of Medicine, Brigham and Women's Hospital, Harvard Medical School, Boston; 4The Broad Institute, Cambridge, Massachusetts; and 5Department of Dermatology, University of Essen, Essen, Germany
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Glenn S. Cowley
1Department of Medical Oncology and 2Center for Cancer Genome Discovery, Dana-Farber Cancer Institute; and 3Department of Medicine, Brigham and Women's Hospital, Harvard Medical School, Boston; 4The Broad Institute, Cambridge, Massachusetts; and 5Department of Dermatology, University of Essen, Essen, Germany
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Dirk Schadendorf
1Department of Medical Oncology and 2Center for Cancer Genome Discovery, Dana-Farber Cancer Institute; and 3Department of Medicine, Brigham and Women's Hospital, Harvard Medical School, Boston; 4The Broad Institute, Cambridge, Massachusetts; and 5Department of Dermatology, University of Essen, Essen, Germany
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
David E. Root
1Department of Medical Oncology and 2Center for Cancer Genome Discovery, Dana-Farber Cancer Institute; and 3Department of Medicine, Brigham and Women's Hospital, Harvard Medical School, Boston; 4The Broad Institute, Cambridge, Massachusetts; and 5Department of Dermatology, University of Essen, Essen, Germany
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Levi A. Garraway
1Department of Medical Oncology and 2Center for Cancer Genome Discovery, Dana-Farber Cancer Institute; and 3Department of Medicine, Brigham and Women's Hospital, Harvard Medical School, Boston; 4The Broad Institute, Cambridge, Massachusetts; and 5Department of Dermatology, University of Essen, Essen, Germany
1Department of Medical Oncology and 2Center for Cancer Genome Discovery, Dana-Farber Cancer Institute; and 3Department of Medicine, Brigham and Women's Hospital, Harvard Medical School, Boston; 4The Broad Institute, Cambridge, Massachusetts; and 5Department of Dermatology, University of Essen, Essen, Germany
1Department of Medical Oncology and 2Center for Cancer Genome Discovery, Dana-Farber Cancer Institute; and 3Department of Medicine, Brigham and Women's Hospital, Harvard Medical School, Boston; 4The Broad Institute, Cambridge, Massachusetts; and 5Department of Dermatology, University of Essen, Essen, Germany
1Department of Medical Oncology and 2Center for Cancer Genome Discovery, Dana-Farber Cancer Institute; and 3Department of Medicine, Brigham and Women's Hospital, Harvard Medical School, Boston; 4The Broad Institute, Cambridge, Massachusetts; and 5Department of Dermatology, University of Essen, Essen, Germany
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
DOI: 10.1158/2159-8290.CD-12-0470 Published March 2013
  • Article
  • Figures & Data
  • Info & Metrics
  • PDF
Loading

Abstract

RAF inhibitors such as vemurafenib and dabrafenib block BRAF–mediated cell proliferation and achieve meaningful clinical benefit in the vast majority of patients with BRAFV600E-mutant melanoma. However, some patients do not respond to this regimen, and nearly all progress to therapeutic resistance. We used a pooled RNA interference screen targeting more than 16,500 genes to discover loss-of-function events that could drive resistance to RAF inhibition. The highest ranking gene was NF1, which encodes neurofibromin, a tumor suppressor that inhibits RAS activity. NF1 loss mediates resistance to RAF and mitogen-activated protein kinase (MAPK) kinase kinase (MEK) inhibitors through sustained MAPK pathway activation. However, cells lacking NF1 retained sensitivity to the irreversible RAF inhibitor AZ628 and an ERK inhibitor. NF1 mutations were observed in BRAF–mutant tumor cells that are intrinsically resistant to RAF inhibition and in melanoma tumors obtained from patients exhibiting resistance to vemurafenib, thus showing the clinical potential for NF1-driven resistance to RAF/MEK-targeted therapies.

Significance: This work identifies functional loss of NF1 as a mediator of resistance to RAF inhibitors in BRAFV600E-mutant cancers. Furthermore, we nominate new therapeutic modalities to treat this mechanism of resistance. Cancer Discov; 3(3); 350–62. ©2012 AACR.

See related commentary by Gibney and Smalley, p. 260

This article is highlighted in the In This Issue feature, p. 239

Introduction

Cancer therapy has arguably entered a transformation fueled by the success of targeted agents such as kinase inhibitors deployed against tumors harboring “druggable” oncogene mutations. Unfortunately, resistance to these therapies remains a formidable challenge (1). In some cases of therapeutic resistance, cancer patients fail to respond to treatment at the outset (termed de novo or innate resistance). Alternatively, resistance may emerge after several weeks or months of clinical response (termed acquired resistance).

The identification of BRAF mutations as key driver events in malignant melanoma spurred the development of small-molecule inhibitors of the mitogen-activated protein kinase (MAPK) pathway in an effort to block dysregulated signal transduction engendered by the mutant BRAF oncoprotein. As a result, RAF inhibitors such as vemurafenib or dabrafenib, or mitogen-activated protein kinase (MAPK) kinase kinase (MEK) inhibitors such as trametinib, elicited striking clinical response rates when administered as single agents in patients with BRAFV600E-mutant melanomas (2–4). The use of RAF and MEK inhibitors in combination further extends the magnitude and duration of clinical benefit (5). However, intrinsic or acquired resistance to these regimens remains a major clinical problem. Systematic characterization of resistance to these agents is therefore needed to further the development of combined therapeutic strategies that either complement existing therapies or provide alternative treatment avenues.

Several mechanisms of resistance to vemurafenib have been described, most of which involve reactivation of downstream MEK/extracellular signal-regulated kinase (ERK) signaling. Interestingly, secondary mutations involving the BRAF gatekeeper residue (a threonine at codon 529), common in drug-resistant chronic myelogenous leukemia (CML) and epidermal growth factor receptor (EGFR)-mutant lung cancers, have not been observed, although preclinical data may support such a mechanism (6–9). A number of laboratories have generated resistant cell line subclones by chronic exposure to RAF inhibitors in vitro, which may facilitate identification of resistance mechanisms by functional or genomic characterization of these cells. Such efforts have implicated amplification or mutation of RAS isoforms (10), enhanced CRAF expression (11), activation of receptor tyrosine kinases (12), and a splice variant of BRAF that constitutively dimerizes in the presence of inhibitor, producing sustained MEK/ERK signaling (13). In addition, systematic gain-of-function screens identified COT (MAP3K8) as a resistance effector (14). Moreover, secretion of hepatocyte growth factor (HGF) by stromal cells may activate MET to promote resistance to BRAF inhibition (15, 16). In aggregate, these studies provided a rationale for the combined use of RAF and MEK inhibitors and, potentially, additional therapeutic avenues that may overcome specific resistance mechanisms.

Genome-scale RNA interference (RNAi) screens may offer a systematic and unbiased genetic approach to study tumor biology and therapeutic resistance. To elucidate potential loss-of-function mechanisms of resistance to BRAF or MEK inhibition, we conducted a pooled, lentiviral short hairpin RNA (shRNA) screen in drug-sensitive BRAF–mutant melanoma cells exposed to high RAF inhibitor concentrations. Characterization of surviving cells identified inactivation of NF1 as a novel mechanism of resistance to both BRAF and MEK inhibition.

Results

To identify genes capable of suppressing resistance to BRAF inhibition, we used a library of 90,000 shRNAs targeting approximately 16,600 genes expressed in A375 cells, which harbor the BRAFV600E mutation and are sensitive to small-molecule RAF and MEK inhibitors (17). Following infection with the lentiviral shRNA library, these cells were cultured in the presence of either dimethyl sulfoxide (DMSO) or 3 μmol/L of the RAF inhibitor PLX4720 for 14 and 7 population doublings, respectively (Fig. 1A and B). A drug-resistant population began to emerge within 2 weeks following shRNA infection (Fig. 1B), whereas cells expressing a control shRNA-targeting red fluorescent protein (shRFP) remained fully inhibited during this time frame (data not shown). The relative abundance of each shRNA was determined by PCR amplification and massively parallel sequencing of lentiviral library DNA (see Methods). The log fold enrichment for shRNAs in the PLX4720-treated arm compared with the DMSO-treated arm was assessed. Using RNAi gene enrichment (RIGER) analysis (18), a ranked gene list was generated on the basis of the degree of enrichment of shRNAs targeting a given gene in the PLX4720-treated arm (Fig. 1C). Only 31 genes had 2 or more shRNAs ranked in the top 1,000 enriched subgroup (a criterion for candidacy as a “hit” from this screen; Supplementary Table S1). The top-ranking gene was NF1, which encodes the RAS-GTPase–activating protein (RAS-GAP) neurofibromin (19). In particular, enrichment of 2 shRNAs targeting NF1 was clearly observed across 6 PLX4720-treated replicates (Fig. 1D). These data raised the possibility that suppression of NF1 activity might permit proliferation of BRAF–mutant melanoma cells in the presence of the RAF inhibitor.

Figure 1.
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 1.

A genome-wide RNAi pooled screen identifies NF1 as a key determinant of RAF inhibitor sensitivity in melanoma cells. A, outline of the pooled screening strategy used in-BRAFV600E A375 melanoma cells. A 90,000 shRNA-pooled lentiviral library targeting approximately 16,600 genes was introduced into the cells, and selection of infected cells was achieved using 0.5 μg/mL puromycin for 3 days. Cells were then treated with either DMSO or 3 μmol/L PLX4720 for up to 14 population doublings. shRNA sequences were amplified by PCR, and the relative abundance of each shRNA was determined by Illumina sequencing. PD, population doubling. B, growth of A375 cells infected with approximately 90,000 shRNAs and cultured in the presence of either DMSO or 3 μmol/L PLX4720 for up to 14 population doublings. C, the number of reads per shRNA was normalized and log2 transformed, and shRNA data for 2 DMSO controls and 6 PLX4720-treated replicas were analyzed using a “second-best shRNA”, 2-class comparison of log-fold change (LFC) in RIGER to generate a ranked list of genes that were enriched in the PLX4720-treated cells. The screening hits are visualized by plotting the function y = 1/normalized enrichment score (NES). The top 5-ranking candidate genes are indicated. D, heat map of shRNA representation across early time point (ETP), DMSO-, and PLX4720-treated replicas for the screen. shRNAs 39714 and 39717 were enriched across all drug-treated replicates. E, validation of shRNA-mediated knockdown of NF1 in A375 cells. A375 cells were infected with shRNAs against luciferase or NF1; after selection in puromycin, cell lysates were made and levels of NF1 protein were determined by Western blotting. F, A375 cells infected with either shLuc or shNF1 were cultured in the presence or absence of 3 μmol/L PLX4720 for 2 weeks. Cells were fixed, then stained with crystal violet and photographed.

To validate this observation, A375 cells were reinfected with 2 distinct shRNAs targeting NF1. Reduced expression of NF1 protein was then confirmed by Western blotting (Fig. 1E), and cell proliferation was assessed in the presence or absence of 3 μmol/L PLX4720 for 2 weeks. Both NF1 shRNAs permitted robust cell proliferation (as measured by a colony formation assay in vitro) in the presence of PLX4720 (Fig. 1F). These results suggested that loss of NF1 in A375 cells might reduce cellular dependency on oncogenic BRAF for proliferation.

To determine whether suppression of NF1 could provide a generalizable loss-of-function mechanism of resistance to RAF inhibition, the BRAF–mutant melanoma cell lines SKMEL28 and UACC62 were treated with PLX4720 alongside A375 cells following infection with the shNF1 constructs. In each case, sustained cell proliferation in the presence of the RAF inhibitor was observed following NF1 silencing, compared with cells expressing a control shRNA (Fig. 2A). Indeed, suppression of NF1 conferred a 5- to 31-fold shift in the concentration required to inhibit cell proliferation by 50% (GI50) for PLX4720 (e.g., up to 2.2–3.5 μmol/L compared with 0.112 μmol/L in control A375 cells). By comparison, ectopic expression of oncogenic KRASG12V, a positive control for resistance to PLX4720 (and which is functionally equivalent to oncogenic forms of NRAS; ref. 14), produced a GI50 of 26.3 μmol/L. In parallel, cells were treated with 1 μmol/L PLX4720 for 16 hours, and cell lysates were analyzed by Western blotting for ERK phosphorylation (Fig. 2B). Loss of NF1 enabled sustained ERK phosphorylation in the presence of PLX4720 compared with mock-treated or shLuc-treated cells, although to a lesser extent than the KRASG12V control (Fig. 2B). Thus, NF1 silencing was sufficient to confer resistance to RAF inhibition in multiple BRAFV600E melanoma cell contexts.

Figure 2.
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 2.

Knockdown of NF1 drives resistance to selective BRAF inhibitors through reactivation of the MAPK pathway. A, A375, SKMEL28, and UACC62 cells are resistant to PLX4720 following knockdown of NF1. shRNA-infected cells were treated with a 10-point concentration response of the inhibitor for 4 days, and cell proliferation was determined using CellTiter-glo (Promega). Cells were also infected with LacZ and KRASG12V-expressing lentivirus to act as negative and positive controls, respectively. B, loss of NF1 is permissive for MAPK signaling in the presence of BRAF inhibitors. shRNA-infected A375, SKMEL28, and UACC62 cells were treated with the indicated concentrations of the inhibitors for 16 hours, and cell lysates were made and analyzed by Western blotting for the indicated proteins. Cells were also infected with LacZ and KRASG12V-expressing lentivirus to act as negative and positive controls, respectively.

Recent whole-exome sequencing studies of melanoma tumors suggest that mutant NF1 might provide a “driver” genetic event that dysregulates MAPK signaling in some melanoma cells that lack BRAF and NRAS mutations. BRAF/NRAS wild-type melanoma cells are typically unresponsive to RAF inhibition (20–22). We therefore sought to test the ability of NF1 silencing to compensate for mutated BRAF and to modulate sensitivity to RAF inhibitors in an immortalized melanocyte model system (23). Knockdown of NF1 in primary human melanocytes expressing oncogenic BRAF caused a 10-fold shift in the PLX4720 GI50, permitted robust proliferation in the presence of 3 μmol/L PLX4720, and allowed sustained ERK phosphorylation in the presence of 0.2 and 1 μmol/L PLX4720 (Supplementary Fig. S1A–S1C). These experiments provide independent evidence that silencing of NF1 could confer resistance to RAF inhibition in a MAPK pathway-dependent manner.

Given that NF1 is a known negative regulator of RAS activity (24), we queried the activation state of RAS in A375 cells following NF1 knockdown using a RAS-GTP pull-down assay. As expected, NF1 suppression caused a substantial increase in the level of active GTP-bound RAS (Fig. 3A). Associated with the increased RAS-GTP, we observed a concomitant increase in CRAF activation, as measured by phosphorylation of Ser338 (Fig. 3B). CRAF (Ser338) phosphorylation was further enhanced in the presence of PLX4720, suggesting that the enhanced RAS-GTP produced by NF1 silencing was competent to potentiate so-called “paradoxical” RAF activation (25–27).

Figure 3.
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 3.

Activation of RAS and CRAF drives resistance to PLX4720. A, A375 cells were depleted of NF1 using shRNA, and RAS-GTP levels in A375 cells were determined by a RAS-GTP affinity pull-down, followed by Western blotting for the indicated proteins. B, combinatorial knockdown of NF1 and CRAF abrogates NF1-mediated resistance to BRAF inhibition at the level of ERK phosphorylation (pERK). A375 cells were infected with NF1 shRNA and treated with either DMSO or PLX4720 for 16 hours. Cell lysates were analyzed for the indicated proteins. C, combinatorial knockdown of NF1 and CRAF abrogates NF1-mediated resistance to RAF inhibition. Quantitative analysis of the Western blots from Fig. 3B for pERK normalized to ERK2 (red) and for cyclin D1 normalized to vinculin (green). Data from 3 independent experiments is presented. D, combinatorial knockdown of NF1 and CRAF abrogated NF1-mediated resistance to RAF inhibition. shRNA-infected cells were treated with a 10-point concentration response of the inhibitors for 4 days, and cell proliferation was determined using CellTiter-glo.

On the basis of these observations, we next tested the requirement for CRAF to mediate NF1-driven resistance to RAF inhibition by conducting combined shRNA-mediated knockdown of both CRAF and NF1, followed by assessment of MAPK signaling and sensitivity to RAF inhibition. Silencing of CRAF alone had little effect on the responsiveness of MAPK signaling to PLX4720; this was expected given prior observations that CRAF is inactive in BRAFV600E melanoma under steady-state conditions (28). However, under conditions of combined CRAF/NF1 knockdown, ERK phosphorylation was inhibited more effectively compared with knockdown of NF1 alone (Fig. 3B). Moreover, whereas cyclin D1 levels were inhibited by PLX4720 in A375 cells (as expected given the known regulation of this protein by MAPK signaling in BRAFV600E melanoma), NF1 silencing partially alleviated this effect (Fig. 3B). Effects of PLX4720 on cyclin D1 protein expression were restored when both NF1 and CRAF were depleted concomitantly. Quantitative analysis of the Western blots confirmed these observations (Fig. 3C). Cellular sensitivity to PLX4720 followed a similar trend, whereby combinatorial knockdown of CRAF and NF1 reversed the resistance to PLX4720 conferred by NF1 loss (Fig. 3D).

Having established that the loss of NF1 could promote resistance to RAF inhibition, we sought to determine whether NF1 silencing could also affect sensitivity to pharmacologic MEK inhibition. In particular, we hypothesized that inhibition of MEK, a substrate of both BRAF and CRAF, might have equal potency regardless of NF1 expression (given that MEK is a limiting MAPK effector downstream of CRAF). Interestingly, cells exhibiting NF1 knockdown were partially resistant to AZD6244 (Fig. 4A). Here, NF1 silencing increased the GI50 to the MEK inhibitor AZD6244 by approximately 7-fold. ERK phosphorylation was also sustained in the presence of AZD6244 (Fig. 4B). Combined inhibition of BRAF and MEK by simultaneous treatment with PLX4720 and AZD6244 achieved greater efficacy than either agent alone; however, NF1 knockdown was still associated with residual resistance to combined RAF/MEK inhibition in vitro (Fig. 4C). Moreover, a clear correlation was evident between residual ERK phosphorylation and inhibition of cell proliferation (Fig. 4D). Thus, a resistance phenotype remained apparent in the setting of NF1 knockdown even under the conditions of combined RAF/MEK inhibitor exposure.

Figure 4.
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 4.

Both MEK inhibition and combined RAF/MEK inhibition do not completely reverse NF1-mediated resistance. A, A375 cells infected with shRNAs targeting NF1 were treated with a 10-point concentration response of AZD6244 for 4 days and cell proliferation determined using CellTiter-glo. Cells were also infected with LacZ- and KRASG12V-expressing lentivirus to act as negative and positive controls, respectively. B, in parallel to the above, cells were treated with 0.2 μmol/L AZD6244 for 16 hours, and cell lysates were analyzed by Western blotting for the indicated proteins. C, combinatorial inhibition of BRAF and MEK using PLX4720 and AZD6244 did not fully overcome NF1-mediated resistance. A375 cells were infected with the stated shRNAs/open reading frames (ORF) and then exposed to a 10-point concentration response of PLX4720 alone or PLX4720 plus 0.2 μmol/L AZD6244 for 4 days. Cell proliferation was determined by CellTiter-glo. D, combined BRAF/MEK inhibition did not fully block NF1-mediated resistance at the level of ERK phosphorylation. A375 cells were infected with shRNAs/ORFs as above and then treated with DMSO (D), 1 μmol/L PLX4720 (P), 0.2 μmol/L AZD6244 (A), or a combination of PLX4720 and AZD6244 (C) for 16 hours. Cell lysates were analyzed by Western blotting for the indicated proteins.

In the presence of activated RAS, PLX4720 can activate CRAF through loss of feedback inhibition and induction of RAF dimerization (25–27). Conceivably, then, the RAS activation engendered by NF1 loss might promote a biochemical state wherein the activated RAF/MEK complex is less vulnerable to MEK inhibition, particularly under conditions of concomitant RAF inhibitor exposure. To test this hypothesis, we used the irreversible RAF inhibitor AZ628. This compound prevents CRAF activation due to persistent occupation of the ATP-binding site (25). In contrast with the aforementioned drug conditions, only minimal resistance (2-fold) was observed to AZ628 (Fig. 5A). Moreover, ERK phosphorylation was effectively suppressed (between 80%–90%) by this irreversible inhibitor, even in the setting of NF1 knockdown, but only by 65% in the presence of oncogenic KRAS (Fig. 5B). Furthermore, combined NF1/CRAF knockdown resensitized cells to treatment with the MEK inhibitor (Supplementary Fig. S2). These results provide additional support for the notion that CRAF signaling is required for the resistance phenotype induced by NF1 loss.

Figure 5.
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 5.

Cells lacking NF1 expression are sensitive to sustained BRAF/CRAF inhibition and to ERK inhibition. A, A375 cells infected with the indicated shRNAs/ORFs were treated with a 10-point concentration response of AZ628 for 4 days and cell proliferation determined using CellTiter-glo. B, in parallel to the above, cells were also treated with 0.2 μmol/L AZ628 for 16 hours, and cell lysates were analyzed by Western blotting for the indicated proteins. C, A375 cells infected with the indicated shRNAs/ORFs were treated with a 10-point concentration response of VTX-11e for 4 days, and cell proliferation was determined using CellTiter-glo. D, in parallel to the above, cells were also treated with 1 μmol/L VTX-11e for 16 hours, and cell lysates were analyzed by Western blotting for the indicated proteins.

We also tested the effect of pharmacologic ERK inhibition in this setting using the compound VTX-11e (29). Interestingly, BRAFV600E melanoma cells harboring NF1 knockdown remained sensitive to ERK inhibition (Fig. 5C). Consistent with this observation, phosphorylation of the ERK substrate FRA1 (FOS-like antigen 1) was inhibited equally in the presence or absence of NF1 knockdown (Fig. 5D). This pattern of activity was confirmed in colony formation assays, whereby robust resistance was observed to the selective RAF inhibitors PLX4720, PLX4032, GDC0879, and the MEK inhibitor AZD6244. However, NF1 knockdown produced only modest resistance to the irreversible RAF inhibitor AZ628 and caused no resistance to the ERK inhibitor VTX-11e (Supplementary Fig. S3A and S3B).

To understand the potential for endogenous NF1 inactivation to mediate resistance to RAF inhibition, we leveraged the Cancer Cell Line Encyclopedia (CCLE; 30) to identify cell line models that contained putative inactivating NF1 mutations in the context of oncogenic BRAFV600E mutation. Toward this end, over 500 CCLE lines have previously been profiled for pharmacologic sensitivity to RAF and MEK inhibition (30). We identified 5 BRAFV600E cell lines (3 melanomas and 2 colorectal tumors) with co-occurring mutations in NF1 (Supplementary Fig. S4). Of these, 3 contained obvious “damaging” NF1 mutations (HS695T: NF1Q959*, LOXIMVI: NF1Q1174* and RKO: NF1L626fs,Q2340fs,V2205A), whereas 2 contained point mutations (WM88: NF1R1306Q, LS411N: NF1T2805I), deemed unlikely to affect NF1 function according to the Mutation Assessor algorithm (data not shown; ref. 31). HS695T and RKO cells also exhibited reduced NF1 mRNA expression. First, we assessed NF1 protein expression by Western blotting, and those cell lines with damaging mutations in NF1expressed significantly less protein than the wild-type cells (Fig. 6A). The sensitivity of HS695T, LOXIMVI, and RKO cells to MAPK pathway inhibition by PLX4720 was assessed alongside A375, SKMEL28, and UACC62 BRAFV600E/NF1WT melanoma cells. BRAFV600E cell lines that expressed no or undetectable levels of NF1 protein (LOXIMVI and RKO) were highly resistant to the inhibition of ERK phosphorylation by PLX4720, whereas HS695T cells that expressed low levels of NF1 protein were still relatively sensitive (Fig. 6B). In accord with this finding, NF1 mutation was correlated with resistance to PLX4720 in these cells (Fig. 6C). The mean GI50 was 0.247 μmol/L in NF1 wild-type cells, which increased more than 50-fold in the NF1-mutant cell lines to 15.8 μmol/L

Figure 6.
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 6.

Loss of NF1 is observed in some BRAF–mutant human melanoma and colorectal cell lines. A, melanoma and colorectal cancer cell lines from the Broad Cancer Cell Line Encyclopedia were assessed for expression of BRAFV600E and damaging mutations in NF1. Three such lines were identified (HS695T, LOXIMVI, and RKO, in red) and analyzed alongside a panel of BRAFV600E/NF1WT cells (blue) for expression of NF1 protein by quantitative Western blotting. A 2-tailed t test was conducted to determine whether the expression of NF1 protein was significantly different between cells expressing either wild-type (WT) or mutant (MT) protein. B–D, Cells with wild-type NF1 are shown as blue, and those with mutant NF1 are shown as red. B, reduced expression of NF1 protein is associated with resistance to PLX4720. NF1 wild-type and mutant cell lines were treated with a 10-point titration of PLX4720 for 16 hours, and ERK phosphorylation was assessed using an In-cell Western assay. C, reduced expression of NF1 protein is associated with resistance to PLX4720. NF1 wild-type and mutant cell lines were treated with a 10-point titration of PLX4720 for 4 days, and cell proliferation was assessed using CellTiter-glo. D, human BRAF- and NF1-mutant melanoma and colorectal cancer cell lines display only modest resistance to inhibition of ERK. Cells were exposed to a 10-point titration of the ERK inhibitor VTX-11e for 4 days and cell proliferation was assessed using CellTiter-glo.

Given that NF1 knockdown did not confer resistance to pharmacologic ERK inhibition in A375 cells (as described above), we tested the hypothesis that BRAFV600E/NF1-mutant cancer cell lines might remain sensitive to VTX-11e. Notably, the ERK inhibitor showed activity against NF1-mutant cell lines with a mean GI50 of 0.781 μmol/L compared with 0.219 μmol/L in BRAF–mutant cells with wild-type NF1 (Fig. 6D). These results suggest that pharmacologic ERK inhibition might in principle provide a viable therapeutic strategy in BRAFV600E cancer cells harboring NF1 loss.

To confirm that NF1 alterations may confer resistance to BRAF inhibition in human melanoma, we assessed the status of NF1 using whole-exome sequencing of tumors from patients who had relapsed during vemurafenib treatment. We identified 4 patients whose tumors expressed mutant alleles of NF1 (Fig. 7A). Of these, one was a nonsense mutation (patient 46, p.R2450*) that would likely result in reduced protein expression. This mutation was present in both pretreatment and postrelapse biopsies, and interestingly the patient had a progression-free survival (PFS) of only about 10 weeks. This short duration of response raised the possibility that the concomitant NF1 mutation conferred intrinsic resistance to vemurafenib (Fig. 7B). The other NF1 mutations were silent events (patient 15, c.135T>C, patient 45 c.4023G>A, and patient 50 c3018C>T) that are not predicted to alter NF1 protein expression. However, given that NF1 is known to be affected by splice-site mutations (32), we assessed the predicted impact of these mutations on both canonical splice sites and exon splice-enhancer sites using the Human Splicing Finder (33). This analysis revealed that all 3 mutations were located within candidate splicing motifs. Conceivably, then, these mutations may produce aberrant NF1 exon splicing. Like patient 46, patients 15 and 50 exhibited response rates of relatively short duration (10 and 12 weeks, respectively). Moreover, these mutations were also observed in both the pretreatment and postrelapse biopsies, consistent with intrinsic resistance to vemurafenib. In contrast, patient 45 experienced a PFS of 5 months, and the NF1 mutation was only present in the postrelapse biopsy (Fig. 7C), indicative of acquired resistance. Together, these observations provide preliminary support for the notion that genomic dysregulation of NF1 may influence both de novo and acquired resistance to RAF inhibition in the clinical arena.

Figure 7.
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 7.

Whole-exome sequencing identifies NF1 mutations in tumors of melanoma patients exhibiting resistance to vemurafenib. A, patients with melanoma who progressed on treatment with vemurafenib were biopsied pre- and posttreatment. Whole-exome sequencing was conducted and NF1 alterations assessed. The NF1 mutations are listed alongside the functional impact on the expressed protein. Silent mutations were assessed for their potential effects on splicing sites using the human splicing finder. The splicing motif affected by the mutation (in red) is indicated and “site broken” indicates potentially damaging effects on splice site function. B, PFS data were extrapolated from Chapman and colleagues (2), and the number of patients who progressed per month is shown in blue, the cumulative number of progressing patients is in gray. NF1 mutations observed in our cohort of patients are overlaid at their respective PFS times. Patients with a PFS of less than 3 months were nominated for de novo resistance, whereas those with a PFS of 3 months or more showed acquired resistance. Three NF1 alterations were observed in pretreatment BRAF–mutant melanoma patient samples, and all 3 patients showed de novo resistance. A fourth patient with a PFS of 5 months exhibited acquired resistance. C, Integrative Genomics Viewer (48) plot showing an NF1 silent mutation observed in the post-relapse biopsy sample only (c.4023G>A) in a patient with a PFS of 5 months.

Discussion

In malignant melanoma, activating BRAF mutations confer exquisite dependency on RAF/MEK/ERK signaling, which has been successfully targeted using small-molecule RAF and MEK inhibitors. However, therapeutic resistance inevitably develops following a period of disease stabilization or regression, and some BRAFV600E-mutant melanomas exhibit intrinsic resistance to these agents (2). Understanding the mechanistic basis of drug resistance is essential to the development of new therapeutic strategies that maximize clinical benefit. Here, we queried resistance to RAF inhibition using an unbiased, genome-scale RNAi screen for modifiers of sensitivity to small-molecule RAF inhibition. Our approach builds upon complementary studies using gain-of-function approaches, such as systematic open reading frame (ORF) overexpression screens (14) or the generation of resistant cell lines by chronic exposure to inhibitors (10, 11, 13, 34).

The identification of NF1 loss as a resistance effector describes one of the first loss-of-function events capable of mediating resistance to RAF inhibitors identified by systematic functional approaches. The protein encoded by the NF1 gene, neurofibromin, is a known tumor suppressor gene and negative regulator of RAS proteins. This function is achieved through stimulation of the GTPase activity of RAS by neurofibromin, thus converting it from an active, GTP-bound form to its inactive GDP-bound form. Therefore, loss of NF1 activates RAS and provides an upstream stimulus to activate CRAF, driving resistance to a RAF inhibitor by reactivation of the MAPK pathway. This finding is consistent with other reported mechanisms whereby RAS is mutated or amplified in vemurafenib-resistant cell lines, signaling through CRAF to maintain MAPK signaling (10, 35). These findings are therefore consistent with several published reports indicating that the majority of resistance mechanisms reported for RAF inhibitors involve reactivation of the MAPK pathway. This underscores a fundamental dependency on RAS signaling potentiated by NF1 loss. This event also confers a CRAF dependency in the setting of pharmacologic RAF inhibition, as evidenced by a near-complete reversal of the resistance phenotype by CRAF knockdown. This observation raises the possibility that, in the future, saturating pharmacologic inhibition of both BRAF and CRAF (and possibly ARAF as well) could reduce the capacity for resistance to develop. Such inhibition might be achieved by an irreversible RAF inhibitor that promotes an inactive conformation of RAF. Consistent with this notion is the observation that NF1 was unable to confer resistance to AZ628, a tool compound with these characteristics (25). Consequently, we hypothesized that either a single-agent MEK inhibitor or combined RAF and MEK inhibition might circumvent NF1-mediated resistance. Indeed, combined exposure displayed more potent activity in vitro than did either agent alone in the setting of NF1 knockdown. However, the drug combinations tested herein did not fully restore sensitivity, at least in vitro. Conceivably, this limitation may be overcome by more potent MEK inhibitors or clinical RAF/MEK regimens that enable more complete suppression of MEK/ERK signaling. Alternatively, CRAF may have MEK-independent roles in tumor cell survival and proliferation (36–39). Therefore, although combined RAF/MEK inhibition certainly improves clinical responses in BRAF–mutant melanoma (5), the potential for NF1 loss (and perhaps other mechanisms of upstream RAS activation) to drive resistance may remain. On the other hand, melanoma cells harboring NF1 knockdown remained sensitive to a selective ERK inhibitor, suggesting that ERK may represent a pivotal integration point for upstream MAPK signaling and may offer therapeutic potential for circumventing multiple resistance mechanisms.

To ascertain whether NF1 loss might provide an endogenous resistance mechanism, we analyzed cancer cell lines in which NF1 mutation co-occurred with BRAFV600E mutation. Using the CCLE, we identified 5 BRAFV600E cell lines that had NF1 mutations, 3 of which were nonsense mutations. Each of these cell lines was insensitive to PLX4720, consistent with the NF1 shRNA screening and validation results in RAF inhibitor–sensitive cell lines. Furthermore, by integrating our findings with a published cohort of 121 primary melanoma tumors, metastatic tumors, and short-term cultures (20) previously analyzed by whole-exome sequencing, we gained additional insights into the potential clinical relevance of NF1 mutations. In this cohort, putatively damaging NF1 mutations were observed in 25% (5/21) of samples that lacked highly recurrent mutations in either BRAF or NRAS. Genomic studies of an independent melanoma cohort have also shown this association (21). However, NF1 mutations were also observed in BRAF- or NRAS-mutant tumors, including a splice site mutation (NF1G1166) co-occurring with the activating mutant BRAFK601E,P731S, a nonsense mutation (NF1R440*) cooccurring with NRASQ61K, and a GAP-related domain mutation (NF1P1323L) in a BRAFV600E tumor. Given that both melanoma and colorectal tumors harbor coexisting BRAF and NF1 mutations, it therefore seemed likely that clinical scenarios could arise in which NF1 loss serves as a gating resistance effector in the setting of BRAF/MEK inhibition. Toward this end, we assessed NF1 alterations by whole-exome sequencing in the tumors of patients with melanoma treated with vemurafenib who progressed while on treatment. We identified 4 patients whose tumors had NF1 alterations that could have an impact on protein function or expression. One event resulted in a nonsense mutation in NF1 (p.R2450*), likely to result in nonfunctional protein. The other 3 mutations were silent events, but importantly, they occurred in putative splice regulatory or exon splicing enhancer sites predicted to regulate proper mRNA processing. These data affirm the potential for NF1 alterations to drive both de novo and acquired resistance to vemurafenib in melanoma. As deep genomic/molecular characterization accrues for tumor specimens obtained before treatment, during treatment, and following relapse, the relevance of NF1 loss to clinical resistance should become clearer.

Our data may also endorse the development of irreversible RAF inhibitors. Such agents may, in principle, show benefit in NRAS-mutant tumors because of their enhanced dependency upon CRAF signaling for tumor cell growth. Alternatively, the use of ERK inhibitors may overcome numerous melanoma resistance mechanisms if such agents can be administered safely at doses that achieve robust target inhibition. Toward this end, both irreversible RAF and ERK inhibitors are entering preclinical and clinical trials, thereby offering forthcoming opportunities to evaluate their efficacy in BRAF–mutant cancers. In the aggregate, these results show the promise of systematic preclinical studies combined with knowledge of tumor genetic/molecular alterations to elucidate cancer drug resistance mechanisms that may inform novel therapeutic avenues for many types of cancer.

Methods

Cell Culture and Reagents

Cell lines were obtained from the American Type Culture Collection (ATCC) or the National Cancer Institute (NCI) and cultured in either RMPI-1640 or Dulbecco modified Eagle's medium (Cellgro) and 10% FBS (Gemini Bio-Products) as recommended by the suppliers. Cells were passaged for less than 6 months after receipt and authenticated by short tandem repeat profiling. PLX4720, PLX4032, AZ628, GDC0879, and AZD6244 were purchased from Selleck Chemicals, and the ERK inhibitor VTX-11e was synthesized as previously reported (29). Expression constructs for KRASG12V have been described previously (40). Primary human melanocytes expressing Myc-tagged BRAFV600E were cultured in Ham's F10 medium supplemented with 10% FBS (23).

Pooled Lentiviral shRNA Screen

A375 cells were seeded into 12-well plates at a density of 3 × 106 cells per well, and a total of 7.2 × 107 cells per replicate were infected with a 90,000-shRNA pooled library at a multiplicity of infection of 0.3 to 0.5 (18). Cells were centrifuged for 2 hours at 2,000 rpm, followed by an immediate medium change. The next day, cells were pooled and transduced cells were selected by culturing in the presence of 0.5 μg/mL puromycin for 3 days. Cells were then seeded into T225 flasks for each replica and treated with either DMSO or 3 μmol/L PLX4720. DMSO-treated cells were passaged for up to 14 population doublings, and PLX4720-treated cells were passaged for approximately 7 population doublings. Cells were harvested by trypsinization and stored at −80°C in PBS. Genomic DNA was extracted as described previously (18), and the shRNA sequences were amplified by PCR (41). Here, 140 μg of genomic DNA was split over 60 reactions per sample, and reactions were then repooled per sample before a secondary PCR step. Illumina adapters and independent sample barcodes were incorporated during this secondary PCR step using a scaled-up secondary PCR reaction consisting of six 100 μL reactions, followed by massively parallel sequencing (Illumina). The number of reads for each shRNA was incorporated into the following calculation to normalize between samples: Log2[(shRNA reads/total reads for sample) ×1e6)]. The enrichment of shRNAs in the PLX4720-treated arm relative to the DMSO arm was determined using the RIGER algorithm, “second best shRNA” analysis in GENE-E (http://www.broadinstitute.org/cancer/software/GENE-E/; ref. 18) to produce a ranked list of statistically significant genes based on the degree of corresponding shRNA enrichment in the PLX4720-resistant population. By ranking genes according to the ranking of the “second-best shRNA” per gene, results are influenced less by high-ranking, single shRNA hits for a given gene.

shRNA/ORF Constructs and Lentiviral Infections

All shRNA expression constructs were obtained from The RNAi Consortium and the Broad Institute RNAi Platform. shRNAs were expressed from the lentiviral expression plasmid pLKO.1 or pLKO-TRC005, and virus was produced by transfection of approximately 2.4 × 106 293T cells with 3 μg pLKO.1, 2.7 μg Δ8.9 (gag, pol), and 0.3 μg VSV-G plasmids using 18 μL Fugene6 (Promega). Viral supernatant was harvested 72 hours after transfection. Mammalian cells were infected at a 1:100 dilution of virus in the presence of 4 μg/mL polybrene (Millipore) and centrifuged for 30 minutes at 2,000 rpm. The culture medium was changed immediately after spin infection, and 24 hours later puromycin at a concentration of 0.5–1 μg/mL was added to select for infected cells. pLX304 plasmids for LacZ and KRASG12V were used to generate lentivirus as described above. Cells were infected in the same manner except 10 μg/mL blasticidin (Life Technologies) was used to select for infected cells.

shRNA Constructs Used

The shRNA constructs used in this study include the following:

  • SHC002 MISSION pLKO.1-puro Non-Mammalian shRNA Control, sequence CAACAAGATGAAGAGCACCAA (referred to as shCtrl)

  • TRC0000072243, Luciferase

  • TRC0000039714, NM_000267.1-8468s1c1,NF1

  • TRC0000039717, NM_000267.1-8627s1c1, NF1

  • TRC0000001066, NM_002880.x-1236s1c1, RAF1

Cell Proliferation Assays

Cells were seeded at a density of 0.5 to 5 × 103 cells per well in 96-well plates. The next day, cells were treated with 4 μg/mL polybrene and transduced with shRNA-expressing lentivirus by centrifugation for 30 minutes at 2,000 rpm followed by an immediate medium change. After 3 days, the medium was again changed and compounds were added to the required concentrations. After a further 4 days, cell proliferation was assessed using the CellTiter-glo reagent. GI50 values were determined using GraphPad Prism. For colony formation assays, shRNA-infected cells were seeded at 300 cells per well of a 12-well plate and incubated with 3 μmol/L PLX4720 or DMSO for 2 weeks. Medium containing either DMSO or PLX4720 was changed every 3 to 5 days. Cells were fixed with 4% formaldehyde and stained with 0.5% crystal violet; plates were then washed with distilled water and photographed.

Protein Analysis

Cells were seeded at 5 to 10 × 104 cells per well in 6-well plates. Following treatment, cells were washed with PBS and lysed in 1% SDS lysis buffer. Following protein normalization using the BCA reagent (Sigma), equal amounts of protein were resolved by SDS-PAGE (Life Technologies) and transferred to PVDF-Fl membranes (Bio-Rad). Western blots were blocked with Li-Cor blocking buffer and then probed with the desired antibodies overnight at 4°C. Bands were detected using infrared fluorescence and an Odyssey scanner (Li-Cor Biosciences). Antibodies were obtained from Cell Signaling, Santa Cruz Biotechnology, Sigma, Millipore, BD Biosciences, Li-Cor Biosciences, and Thermo-Fisher Scientific. The determination of RAS-GTP levels in cell lysates was conducted with the RAS Activation Assay Kit (Millipore).

In-cell Western Assay

Cells were seeded in 96-well clear-bottomed, black microtiter plates at 2 × 104 cells per well. The next day, cells were treated with a 10-point titration of PLX4720 for 16 hours. Cells were fixed in 4% formaldehyde, 0.1% TX-100 in PBS for 30 minutes. The wells were blocked with Li-Cor blocking buffer for 30 minutes and incubated with antibodies to phospho-ERK (Sigma) and ERK2 (Santa Cruz Biotechnology) overnight at 4°C. Cells were washed 3 times with 200 μL 0.1% Tween 20 and incubated with Li-Cor secondary antibodies (anti-mouse IR800, anti-rabbit IR680) for 1 hour. The plates were scanned using an Odyssey scanner (Li-Cor) and quantified using the manufacturer's software. ERK phosphorylation was calculated as a percentage of vehicle-treated controls.

Clinical Samples

All melanoma and matched normal samples analyzed were collected and sequenced under an Institutional Review Board–approved protocol (COUHES#0806002814). Standard Broad Institute Sequencing Platform techniques were used for DNA extraction and quality assessment (20).

Library Preparation, Assembly, and Quality Control

Exome capture and library construction were conducted as previously described (42), and libraries were sequenced on Illumina HiSeq 2000 machines. The resulting sequencing data obtained from the Illumina pipeline were assembled using the Picard pipeline (43). Cross-contamination of samples was estimated using ContEst (44), and samples with more than 5% contamination were excluded from this study. Single-nucleotide polymorphism fingerprints from each lane of a tumor/normal pair were crosschecked to confirm concordance, and nonmatching lanes were removed from analysis.

Identification of Somatic Mutations

Somatic single-nucleotide base-pair substitutions were identified using MuTect (45). Annotation of identified mutations for mutation effect was done using Oncotator (46). These algorithms were executed using the Broad Firehose Infrastructure (47).

Disclosure of Potential Conflicts of Interest

N. Wagle has an ownership interest (including patents) and is a consultant/advisory board member for Foundation Medicine. G.S. Cowley and D. Schadendorf have received honoraria from service on the speakers' bureaus from MSD, Roche, and Bristol-Myers Squibb and are consultant/advisory board members of Bristol-Myers Squibb, Roche, GlaxoSmithKline, Amgen, and Novartis. L.A. Garraway has a commercial research grant from Novartis, has ownership interest (including patents) in Foundation Medicine, and is a consultant/advisory board member for Millennium/Takeda, Novartis, and Foundation Medicine. No potential conflicts of interest were disclosed by the other authors.

Authors' Contributions

Conception and design: S.R. Whittaker, D.E. Root, L.A. Garraway

Development of methodology: S.R. Whittaker, J.-P. Theurillat, E.V. Allen, D.E. Root, L.A. Garraway

Acquisition of data (provided animals, acquired and managed patients, provided facilities, etc.): S.R. Whittaker, J.-P. Theurillat, E.V. Allen, N. Wagle, J. Hsiao, G.S. Cowley, D. Schadendorf, D.E. Root

Analysis and interpretation of data (e.g., statistical analysis, biostatistics, computational analysis): S.R. Whittaker, J.-P. Theurillat, E.V. Allen, N. Wagle, L.A. Garraway

Writing, review, and/or revision of the manuscript: S.R. Whittaker, J.-P. Theurillat, E.V. Allen, G.S. Cowley, D. Schadendorf, L.A. Garraway

Administrative, technical, or material support (i.e., reporting or organizing data, constructing databases): J. Hsiao, G.S. Cowley, D. Schadendorf

Study supervision: L.A. Garraway

Grant Support

This study was supported by grants from the National Cancer Institute (5P50CA127003-05) STARR Cancer Consortium (I4-A448), the NIH New Innovator Award (DP2OD002750), and the Melanoma Research Alliance. J.-P. Theurillat is supported by the Swiss Foundation for Grants in Biology and Medicine (PASMP3_134379/1).

Footnotes

  • Note: Supplementary data for this article are available at Cancer Discovery Online (http://cancerdiscovery.aacrjournals.org/).

  • Received October 10, 2012.
  • Revision received December 18, 2012.
  • Accepted December 28, 2012.
  • ©2012 American Association for Cancer Research.

References

  1. 1.↵
    1. Engelman JA,
    2. Settleman J
    . Acquired resistance to tyrosine kinase inhibitors during cancer therapy. Curr Opin Genet Dev 2008;18:73–9.
    OpenUrlCrossRefPubMed
  2. 2.↵
    1. Chapman PB,
    2. Hauschild A,
    3. Robert C,
    4. Haanen JB,
    5. Ascierto P,
    6. Larkin J,
    7. et al.
    Improved survival with vemurafenib in melanoma with BRAF V600E mutation. N Engl J Med 2011;364:2507–16.
    OpenUrlCrossRefPubMed
  3. 3.↵
    1. Flaherty KT,
    2. Robert C,
    3. Hersey P,
    4. Nathan P,
    5. Garbe C,
    6. Milhem M,
    7. et al.
    Improved survival with MEK inhibition in BRAF-mutated melanoma. N Engl J Med 2012;367:107–14.
    OpenUrlCrossRefPubMed
  4. 4.↵
    1. Hauschild A,
    2. Grob JJ,
    3. Demidov LV,
    4. Jouary T,
    5. Gutzmer R,
    6. Millward M,
    7. et al.
    Dabrafenib in BRAF-mutated metastatic melanoma: a multicentre, open-label, phase 3 randomised controlled trial. Lancet 2012;380:358–65.
    OpenUrlCrossRefPubMed
  5. 5.↵
    1. Flaherty KT,
    2. Infante JR,
    3. Daud A,
    4. Gonzalez R,
    5. Kefford RF,
    6. Sosman J,
    7. et al.
    Combined BRAF and MEK inhibition in melanoma with BRAF V600 mutations. N Engl J Med 2012;367:1694–703.
    OpenUrlCrossRefPubMed
  6. 6.↵
    1. Whittaker S,
    2. Kirk R,
    3. Hayward R,
    4. Zambon A,
    5. Viros A,
    6. Cantarino N,
    7. et al.
    Gatekeeper mutations mediate resistance to BRAF-targeted therapies. Sci Transl Med 2010;2:35ra41.
    OpenUrlAbstract/FREE Full Text
  7. 7.↵
    1. Shah NP,
    2. Nicoll JM,
    3. Nagar B,
    4. Gorre ME,
    5. Paquette RL,
    6. Kuriyan J,
    7. et al.
    Multiple BCR-ABL kinase domain mutations confer polyclonal resistance to the tyrosine kinase inhibitor imatinib (STI571) in chronic phase and blast crisis chronic myeloid leukemia. Cancer Cell 2002;2:117–25.
    OpenUrlCrossRefPubMed
  8. 8.↵
    1. Yun CH,
    2. Mengwasser KE,
    3. Toms AV,
    4. Woo MS,
    5. Greulich H,
    6. Wong KK,
    7. et al.
    The T790M mutation in EGFR kinase causes drug resistance by increasing the affinity for ATP. Proc Natl Acad Sci U S A 2008;105:2070–5.
    OpenUrlAbstract/FREE Full Text
  9. 9.↵
    1. Tamborini E,
    2. Bonadiman L,
    3. Greco A,
    4. Albertini V,
    5. Negri T,
    6. Gronchi A,
    7. et al.
    A new mutation in the KIT ATP pocket causes acquired resistance to imatinib in a gastrointestinal stromal tumor patient. Gastroenterology 2004;127:294–9.
    OpenUrlCrossRefPubMed
  10. 10.↵
    1. Nazarian R,
    2. Shi H,
    3. Wang Q,
    4. Kong X,
    5. Koya RC,
    6. Lee H,
    7. et al.
    Melanomas acquire resistance to B-RAF(V600E) inhibition by RTK or N-RAS upregulation. Nature 2010;468:973–7.
    OpenUrlCrossRefPubMed
  11. 11.↵
    1. Montagut C,
    2. Sharma SV,
    3. Shioda T,
    4. McDermott U,
    5. Ulman M,
    6. Ulkus LE,
    7. et al.
    Elevated CRAF as a potential mechanism of acquired resistance to BRAF inhibition in melanoma. Cancer Res 2008;68:4853–61.
    OpenUrlAbstract/FREE Full Text
  12. 12.↵
    1. Corcoran RB,
    2. Ebi H,
    3. Turke AB,
    4. Coffee EM,
    5. Nishino M,
    6. Cogdill AP,
    7. et al.
    EGFR-mediated re-activation of MAPK signaling contributes to insensitivity of BRAF mutant colorectal cancers to RAF inhibition with vemurafenib. Cancer Discov 2012;2:227–35.
    OpenUrlAbstract/FREE Full Text
  13. 13.↵
    1. Poulikakos PI,
    2. Persaud Y,
    3. Janakiraman M,
    4. Kong X,
    5. Ng C,
    6. Moriceau G,
    7. et al.
    RAF inhibitor resistance is mediated by dimerization of aberrantly spliced BRAF(V600E). Nature 2011;480:387–90.
    OpenUrlCrossRefPubMed
  14. 14.↵
    1. Johannessen CM,
    2. Boehm JS,
    3. Kim SY,
    4. Thomas SR,
    5. Wardwell L,
    6. Johnson LA,
    7. et al.
    COT drives resistance to RAF inhibition through MAP kinase pathway reactivation. Nature 2010;468:968–72.
    OpenUrlCrossRefPubMed
  15. 15.↵
    1. Wilson TR,
    2. Fridlyand J,
    3. Yan Y,
    4. Penuel E,
    5. Burton L,
    6. Chan E,
    7. et al.
    Widespread potential for growth-factor-driven resistance to anticancer kinase inhibitors. Nature 2012;487:505–9.
    OpenUrlCrossRefPubMed
  16. 16.↵
    1. Straussman R,
    2. Morikawa T,
    3. Shee K,
    4. Barzily-Rokni M,
    5. Qian ZR,
    6. Du J,
    7. et al.
    Tumour micro-environment elicits innate resistance to RAF inhibitors through HGF secretion. Nature 2012;487:500–4.
    OpenUrlCrossRefPubMed
  17. 17.↵
    1. Emery CM,
    2. Vijayendran KG,
    3. Zipser MC,
    4. Sawyer AM,
    5. Niu L,
    6. Kim JJ,
    7. et al.
    MEK1 mutations confer resistance to MEK and B-RAF inhibition. Proc Natl Acad Sci U S A 2009;106:20411–6.
    OpenUrlAbstract/FREE Full Text
  18. 18.↵
    1. Luo B,
    2. Cheung HW,
    3. Subramanian A,
    4. Sharifnia T,
    5. Okamoto M,
    6. Yang X,
    7. et al.
    Highly parallel identification of essential genes in cancer cells. Proc Natl Acad Sci U S A 2008;105:20380–5.
    OpenUrlAbstract/FREE Full Text
  19. 19.↵
    1. Boguski MS,
    2. McCormick F
    . Proteins regulating Ras and its relatives. Nature 1993;366:643–54.
    OpenUrlCrossRefPubMed
  20. 20.↵
    1. Hodis E,
    2. Watson IR,
    3. Kryukov GV,
    4. Arold ST,
    5. Imielinski M,
    6. Theurillat JP,
    7. et al.
    A landscape of driver mutations in melanoma. Cell 2012;150:251–63.
    OpenUrlCrossRefPubMed
  21. 21.↵
    1. Krauthammer M,
    2. Kong Y,
    3. Ha BH,
    4. Evans P,
    5. Bacchiocchi A,
    6. McCusker JP,
    7. et al.
    Exome sequencing identifies recurrent somatic RAC1 mutations in melanoma. Nat Genet 2012;44:1006–14.
    OpenUrlCrossRefPubMed
  22. 22.↵
    1. Joseph EW,
    2. Pratilas CA,
    3. Poulikakos PI,
    4. Tadi M,
    5. Wang W,
    6. Taylor BS,
    7. et al.
    The RAF inhibitor PLX4032 inhibits ERK signaling and tumor cell proliferation in a V600E BRAF-selective manner. Proc Natl Acad Sci U S A 2010;107:14903–8.
    OpenUrlAbstract/FREE Full Text
  23. 23.↵
    1. Garraway LA,
    2. Widlund HR,
    3. Rubin MA,
    4. Getz G,
    5. Berger AJ,
    6. Ramaswamy S,
    7. et al.
    Integrative genomic analyses identify MITF as a lineage survival oncogene amplified in malignant melanoma. Nature 2005;436:117–22.
    OpenUrlCrossRefPubMed
  24. 24.↵
    1. Xu GF,
    2. Lin B,
    3. Tanaka K,
    4. Dunn D,
    5. Wood D,
    6. Gesteland R,
    7. et al.
    The catalytic domain of the neurofibromatosis type 1 gene product stimulates ras GTPase and complements ira mutants of S. cerevisiae. Cell 1990;63:835–41.
    OpenUrlCrossRefPubMed
  25. 25.↵
    1. Hatzivassiliou G,
    2. Song K,
    3. Yen I,
    4. Brandhuber BJ,
    5. Anderson DJ,
    6. Alvarado R,
    7. et al.
    RAF inhibitors prime wild-type RAF to activate the MAPK pathway and enhance growth. Nature 2010;464:431–5.
    OpenUrlCrossRefPubMed
  26. 26.↵
    1. Heidorn SJ,
    2. Milagre C,
    3. Whittaker S,
    4. Nourry A,
    5. Niculescu-Duvas I,
    6. Dhomen N,
    7. et al.
    Kinase-dead BRAF and oncogenic RAS cooperate to drive tumor progression through CRAF. Cell 2010;140:209–21.
    OpenUrlCrossRefPubMed
  27. 27.↵
    1. Poulikakos PI,
    2. Zhang C,
    3. Bollag G,
    4. Shokat KM,
    5. Rosen N
    . RAF inhibitors transactivate RAF dimers and ERK signalling in cells with wild-type BRAF. Nature 2010;464:427–30.
    OpenUrlCrossRefPubMed
  28. 28.↵
    1. Dumaz N,
    2. Hayward R,
    3. Martin J,
    4. Ogilvie L,
    5. Hedley D,
    6. Curtin JA,
    7. et al.
    In melanoma, RAS mutations are accompanied by switching signaling from BRAF to CRAF and disrupted cyclic AMP signaling. Cancer Res 2006;66:9483–91.
    OpenUrlAbstract/FREE Full Text
  29. 29.↵
    1. Aronov AM,
    2. Tang Q,
    3. Martinez-Botella G,
    4. Bemis GW,
    5. Cao J,
    6. Chen G,
    7. et al.
    Structure-guided design of potent and selective pyrimidylpyrrole inhibitors of extracellular signal-regulated kinase (ERK) using conformational control. J Med Chem 2009;52:6362–8.
    OpenUrlCrossRefPubMed
  30. 30.↵
    1. Barretina J,
    2. Caponigro G,
    3. Stransky N,
    4. Venkatesan K,
    5. Margolin AA,
    6. Kim S,
    7. et al.
    The Cancer Cell Line Encyclopedia enables predictive modelling of anticancer drug sensitivity. Nature 2012;483:603–7.
    OpenUrlCrossRefPubMed
  31. 31.↵
    1. Reva B,
    2. Antipin Y,
    3. Sander C
    . Predicting the functional impact of protein mutations: application to cancer genomics. Nucleic Acids Res 2011;39:e118.
    OpenUrlAbstract/FREE Full Text
  32. 32.↵
    1. Pros E,
    2. Gomez C,
    3. Martin T,
    4. Fabregas P,
    5. Serra E,
    6. Lazaro C
    . Nature and mRNA effect of 282 different NF1 point mutations: focus on splicing alterations. Hum Mutat 2008;29:E173–93.
    OpenUrlCrossRefPubMed
  33. 33.↵
    1. Desmet FO,
    2. Hamroun D,
    3. Lalande M,
    4. Collod-Beroud G,
    5. Claustres M,
    6. Beroud C
    . Human Splicing Finder: an online bioinformatics tool to predict splicing signals. Nucleic Acids Res 2009;37:e67.
    OpenUrlAbstract/FREE Full Text
  34. 34.↵
    1. Villanueva J,
    2. Vultur A,
    3. Lee JT,
    4. Somasundaram R,
    5. Fukunaga-Kalabis M,
    6. Cipolla AK,
    7. et al.
    Acquired resistance to BRAF inhibitors mediated by a RAF kinase switch in melanoma can be overcome by cotargeting MEK and IGF-1R/PI3K. Cancer Cell 2010;18:683–95.
    OpenUrlCrossRefPubMed
  35. 35.↵
    1. Su F,
    2. Bradley WD,
    3. Wang Q,
    4. Yang H,
    5. Xu L,
    6. Higgins B,
    7. et al.
    Resistance to selective BRAF inhibition can be mediated by modest upstream pathway activation. Cancer Res 2012;72:969–78.
    OpenUrlAbstract/FREE Full Text
  36. 36.↵
    1. Chen J,
    2. Fujii K,
    3. Zhang L,
    4. Roberts T,
    5. Fu H
    . Raf-1 promotes cell survival by antagonizing apoptosis signal-regulating kinase 1 through a MEK-ERK independent mechanism. Proc Natl Acad Sci U S A 2001;98:7783–8.
    OpenUrlAbstract/FREE Full Text
  37. 37.↵
    1. Mielgo A,
    2. Seguin L,
    3. Huang M,
    4. Camargo MF,
    5. Anand S,
    6. Franovic A,
    7. et al.
    A MEK-independent role for CRAF in mitosis and tumor progression. Nat Med 2011;17:1641–5.
    OpenUrlCrossRefPubMed
  38. 38.↵
    1. Navas TA,
    2. Baldwin DT,
    3. Stewart TA
    . RIP2 is a Raf1-activated mitogen-activated protein kinase kinase. J Biol Chem 1999;274:33684–90.
    OpenUrlAbstract/FREE Full Text
  39. 39.↵
    1. O'Neill E,
    2. Rushworth L,
    3. Baccarini M,
    4. Kolch W
    . Role of the kinase MST2 in suppression of apoptosis by the proto-oncogene product Raf-1. Science 2004;306:2267–70.
    OpenUrlAbstract/FREE Full Text
  40. 40.↵
    1. Yang X,
    2. Boehm JS,
    3. Salehi-Ashtiani K,
    4. Hao T,
    5. Shen Y,
    6. Lubonja R,
    7. et al.
    A public genome-scale lentiviral expression library of human ORFs. Nat Methods 2011;8:659–61.
    OpenUrlCrossRefPubMed
  41. 41.↵
    1. Ashton JM,
    2. Balys M,
    3. Neering SJ,
    4. Hassane DC,
    5. Cowley G,
    6. Root DE,
    7. et al.
    Gene sets identified with oncogene cooperativity analysis regulate in vivo growth and survival of leukemia stem cells. Cell Stem Cell 2012;11:359–72.
    OpenUrlCrossRefPubMed
  42. 42.↵
    1. Gnirke A,
    2. Melnikov A,
    3. Maguire J,
    4. Rogov P,
    5. LeProust EM,
    6. Brockman W,
    7. et al.
    Solution hybrid selection with ultra-long oligonucleotides for massively parallel targeted sequencing. Nat Biotechnol 2009;27:182–9.
    OpenUrlCrossRefPubMed
  43. 43.↵
    Picard. [cited 2013 Feb 7]. Available from: http://picard.sourceforge.net/.
  44. 44.↵
    1. Cibulskis K,
    2. McKenna A,
    3. Fennell T,
    4. Banks E,
    5. DePristo M,
    6. Getz G
    . ContEst: estimating cross-contamination of human samples in next-generation sequencing data. Bioinformatics 2011;27:2601–2.
    OpenUrlAbstract/FREE Full Text
  45. 45.↵
    MuTect [cited 2013 Feb 7]. Available from: http://www.broadinstitute.org/cancer/cga/mutect.
  46. 46.↵
    Oncotator [cited 2013 Feb 7]. Available from: http://www.broadinstitute.org/cancer/cga/oncotator.
  47. 47.↵
    Firehose [cited 2013 Feb 7]. Available from: http://www.broadinstitute.org/cancer/cga/Firehose.
  48. 48.↵
    1. Robinson JT,
    2. Thorvaldsdottir H,
    3. Winckler W,
    4. Guttman M,
    5. Lander ES,
    6. Getz G,
    7. et al.
    Integrative genomics viewer. Nat Biotechnol 2011;29:24–6.
    OpenUrlCrossRefPubMed
PreviousNext
Back to top
Cancer Discovery: 3 (3)
March 2013
Volume 3, Issue 3
  • Table of Contents
  • Table of Contents (PDF)
  • About the Cover

Sign up for alerts

View this article with LENS

Open full page PDF
Article Alerts
Sign In to Email Alerts with your Email Address
Email Article

Thank you for sharing this Cancer Discovery article.

NOTE: We request your email address only to inform the recipient that it was you who recommended this article, and that it is not junk mail. We do not retain these email addresses.

Enter multiple addresses on separate lines or separate them with commas.
A Genome-Scale RNA Interference Screen Implicates NF1 Loss in Resistance to RAF Inhibition
(Your Name) has forwarded a page to you from Cancer Discovery
(Your Name) thought you would be interested in this article in Cancer Discovery.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.
Citation Tools
A Genome-Scale RNA Interference Screen Implicates NF1 Loss in Resistance to RAF Inhibition
Steven R. Whittaker, Jean-Philippe Theurillat, Eliezer Van Allen, Nikhil Wagle, Jessica Hsiao, Glenn S. Cowley, Dirk Schadendorf, David E. Root and Levi A. Garraway
Cancer Discov March 1 2013 (3) (3) 350-362; DOI: 10.1158/2159-8290.CD-12-0470

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Share
A Genome-Scale RNA Interference Screen Implicates NF1 Loss in Resistance to RAF Inhibition
Steven R. Whittaker, Jean-Philippe Theurillat, Eliezer Van Allen, Nikhil Wagle, Jessica Hsiao, Glenn S. Cowley, Dirk Schadendorf, David E. Root and Levi A. Garraway
Cancer Discov March 1 2013 (3) (3) 350-362; DOI: 10.1158/2159-8290.CD-12-0470
del.icio.us logo Digg logo Reddit logo Twitter logo CiteULike logo Facebook logo Google logo Mendeley logo
  • Tweet Widget
  • Facebook Like
  • Google Plus One

Jump to section

  • Article
    • Abstract
    • Introduction
    • Results
    • Discussion
    • Methods
    • Disclosure of Potential Conflicts of Interest
    • Authors' Contributions
    • Grant Support
    • Footnotes
    • References
  • Figures & Data
  • Info & Metrics
  • PDF
Advertisement

Related Articles

Cited By...

More in this TOC Section

  • SREBP-Transferrin Regulatory Network in Melanoma CTCs
  • Machine-Learning Approach Predicts Hippo Pathway Dependency
  • Type II RAFi and MEKi to Treat MAPK-Addicted Cancers
Show more Research Articles
  • Home
  • Alerts
  • Feedback
  • Privacy Policy
Facebook   Twitter   LinkedIn   YouTube   RSS

Articles

  • OnlineFirst
  • Current Issue
  • Past Issues

Info For

  • Authors
  • Subscribers
  • Advertisers
  • Librarians

About Cancer Discovery

  • About the Journal
  • Editors
  • Journal Sections
  • Permissions
  • Submit a Manuscript
AACR logo

Copyright © 2021 by the American Association for Cancer Research.

Cancer Discovery
eISSN: 2159-8290
ISSN: 2159-8274

Advertisement