Skip to main content
  • AACR Publications
    • Blood Cancer Discovery
    • Cancer Discovery
    • Cancer Epidemiology, Biomarkers & Prevention
    • Cancer Immunology Research
    • Cancer Prevention Research
    • Cancer Research
    • Clinical Cancer Research
    • Molecular Cancer Research
    • Molecular Cancer Therapeutics

AACR logo

  • Register
  • Log in
  • My Cart
Advertisement

Main menu

  • Home
  • About
    • The Journal
    • AACR Journals
    • Journal Sections
    • Subscriptions
    • Reviewing
    • Permissions and Reprints
  • Articles
    • OnlineFirst
    • Current Issue
    • Past Issues
    • Collections
      • COVID-19 & Cancer Resource Center
      • Clinical Trials
      • Immuno-oncology
      • Editors' Picks
      • "Best of" Collection
  • For Authors
    • Information for Authors
    • Author Services
    • Best of: Author Profiles
    • Submit
  • Alerts
    • Table of Contents
    • Editors' Picks
    • OnlineFirst
    • Citation
    • Author/Keyword
    • RSS Feeds
    • My Alert Summary & Preferences
  • News
    • Cancer Discovery News
    • Journal Press Releases
  • COVID-19
  • Webinars
  • 10th Anniversary
  • Search More

    Advanced Search

  • AACR Publications
    • Blood Cancer Discovery
    • Cancer Discovery
    • Cancer Epidemiology, Biomarkers & Prevention
    • Cancer Immunology Research
    • Cancer Prevention Research
    • Cancer Research
    • Clinical Cancer Research
    • Molecular Cancer Research
    • Molecular Cancer Therapeutics

User menu

  • Register
  • Log in
  • My Cart

Search

  • Advanced search
Cancer Discovery
Cancer Discovery
  • Home
  • About
    • The Journal
    • AACR Journals
    • Journal Sections
    • Subscriptions
    • Reviewing
    • Permissions and Reprints
  • Articles
    • OnlineFirst
    • Current Issue
    • Past Issues
    • Collections
      • COVID-19 & Cancer Resource Center
      • Clinical Trials
      • Immuno-oncology
      • Editors' Picks
      • "Best of" Collection
  • For Authors
    • Information for Authors
    • Author Services
    • Best of: Author Profiles
    • Submit
  • Alerts
    • Table of Contents
    • Editors' Picks
    • OnlineFirst
    • Citation
    • Author/Keyword
    • RSS Feeds
    • My Alert Summary & Preferences
  • News
    • Cancer Discovery News
    • Journal Press Releases
  • COVID-19
  • Webinars
  • 10th Anniversary
  • Search More

    Advanced Search

Research Articles

A Genetic Platform to Model Sarcomagenesis from Primary Adult Mesenchymal Stem Cells

Jlenia Guarnerio, Luisa Riccardi, Riccardo Taulli, Takahiro Maeda, Guocan Wang, Robin M. Hobbs, Min Sup Song, Paolo Sportoletti, Rosa Bernardi, Roderick T. Bronson, Mireia Castillo-Martin, Carlos Cordon-Cardo, Andrea Lunardi and Pier Paolo Pandolfi
Jlenia Guarnerio
1Cancer Research Institute, Beth Israel Deaconess Cancer Center, Departments of Medicine and Pathology, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, MA.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Luisa Riccardi
1Cancer Research Institute, Beth Israel Deaconess Cancer Center, Departments of Medicine and Pathology, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, MA.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Riccardo Taulli
1Cancer Research Institute, Beth Israel Deaconess Cancer Center, Departments of Medicine and Pathology, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, MA.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Takahiro Maeda
2Division of Hematology, Department of Medicine, Brigham and Women's Hospital, Harvard Medical School, Boston, Massachusetts.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Guocan Wang
1Cancer Research Institute, Beth Israel Deaconess Cancer Center, Departments of Medicine and Pathology, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, MA.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Robin M. Hobbs
1Cancer Research Institute, Beth Israel Deaconess Cancer Center, Departments of Medicine and Pathology, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, MA.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Min Sup Song
1Cancer Research Institute, Beth Israel Deaconess Cancer Center, Departments of Medicine and Pathology, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, MA.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Paolo Sportoletti
1Cancer Research Institute, Beth Israel Deaconess Cancer Center, Departments of Medicine and Pathology, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, MA.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Rosa Bernardi
3Division of Molecular Oncology, Leukemia Unit, San Raffaele Scientific Institute, Milan, Italy.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Roderick T. Bronson
4Department of Microbiology and Immunology, Rodent Histopathology Care, Harvard Medical School, Boston, Massachusetts.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Mireia Castillo-Martin
5Department of Pathology, Mount Sinai School of Medicine, The Mount Sinai Medical Center, New York, New York.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Carlos Cordon-Cardo
5Department of Pathology, Mount Sinai School of Medicine, The Mount Sinai Medical Center, New York, New York.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Andrea Lunardi
1Cancer Research Institute, Beth Israel Deaconess Cancer Center, Departments of Medicine and Pathology, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, MA.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • For correspondence: ppandolf@bidmc.harvard.edu andrea.lunardi@unitn.it
Pier Paolo Pandolfi
1Cancer Research Institute, Beth Israel Deaconess Cancer Center, Departments of Medicine and Pathology, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, MA.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • For correspondence: ppandolf@bidmc.harvard.edu andrea.lunardi@unitn.it
DOI: 10.1158/2159-8290.CD-14-1022 Published April 2015
  • Article
  • Figures & Data
  • Info & Metrics
  • PDF
Loading

Abstract

The regulatory factors governing adult mesenchymal stem cell (MSC) physiology and their tumorigenic potential are still largely unknown, which substantially delays the identification of effective therapeutic approaches for the treatment of aggressive and lethal forms of MSC-derived mesenchymal tumors, such as undifferentiated sarcomas. Here, we have developed a novel platform to screen and quickly identify genes and pathways responsible for adult MSC transformation, modeled undifferentiated sarcoma in vivo, and, ultimately, tested the efficacy of targeting the identified oncopathways. Importantly, by taking advantage of this new platform, we demonstrate the key role of an aberrant LRF–DLK1–SOX9 pathway in the pathogenesis of undifferentiated sarcoma, with important therapeutic implications.

Significance: The paucity of therapeutic options for the treatment of sarcoma calls for a rapid and effective preclinical assessment of new therapeutic modalities. We have here developed a new platform to deconstruct the molecular genetics underlying the pathogenesis of sarcoma and to evaluatein vivo the efficacy of novel targeted therapies. Cancer Discov; 5(4); 396–409. ©2015 AACR.

This article is highlighted in the In This Issue feature, p. 333

Introduction

Tumorigenesis and stem cell differentiation are frequently tied together, in that genetic and functional loss of genes responsible for cell commitment and differentiation are selected during the tumorigenic process, because undifferentiated cells are often endowed with longer life spans, higher survival, and proliferative potential, and are often resistant to treatment (1).

Adult mesenchymal stem cells (MSC) are known for their ability to self-renew as well as to differentiate into cells of varying mesenchymal lineages, such as chondrocytes, osteoblasts, and adipocytes (2, 3). Importantly, mounting evidence now implicates adult MSCs as the cell of origin of human undifferentiated sarcomas, one of the most aggressive and lethal soft-tissue tumors (4–8). Undifferentiated sarcomas are generally treated by surgical resection (whenever possible), radiotherapy, and chemotherapy; all of these options, however, minimally change the very poor overall survival in patients. Limited genetic and molecular analyses, along with the absence of faithful in vivo models enabling preclinical testing of the targeting of specific tumorigenic pathways, are together the main factors impeding the development of new and more effective therapeutic options. Although specific forms of sarcoma (e.g., osteosarcoma) have been successfully modeled in genetically engineered mice (9–12), current protocols to model undifferentiated sarcomas are generally based on human tumor cell lines transplanted in immune-compromised mice (13), in vitro expanded and spontaneously transformed heterogeneous mouse primary mesenchymal cells (4, 14, 15), or in vitro genetically modified human bone marrow MSCs (16, 17), whose purity and stemness features have recently been debated (3, 18). Although these studies have proved helpful in uncovering aspects of sarcomagenesis, such protocols fail to mirror the real onset and progression of undifferentiated sarcomas because they cannot control key factors such as the type and number of the genetic alterations driving the tumorigenic process or cell of origin (19). In turn, these approaches will hardly allow the discovery of key genetic drivers involved in the onset and progression of undifferentiated sarcomas, and, most importantly, of potential druggable targets with clinical relevance. To fill this void, we have developed a novel ex vivo/in vivo genetic platform that will allow the discovery of genetic drivers responsible for adult MSC transformation and the generation, in vivo, of undifferentiated sarcomas.

Results

Optimized Culture Conditions to Prevent MSCs' Spontaneous Transformation Lead to the Development of a New Genetic Platform to Model Sarcomagenesis

To model undifferentiated sarcomas, we selectively isolated from the bone marrow (BM) of mice a cell population highly enriched for adult MSCs (BM-MSCs: CD45−CD31−Ter119−Sca1+PDGFRα+; Fig. 1A; refs. 20, 21), grew them in vitro, in conditions that maintain their stemness properties, and then studied the genetic drivers leading to their transformation. We have recently described that mimicking in vitro the hypoxic conditions characterizing the natural environment of MSCs within the bone favors the expansion of adult BM-MSCs, while maintaining their stem features (21). This analysis led us to discover that, unexpectedly and in contrast with what has been previously reported for mesenchymal cells cultured in regular oxygen concentrations (20% oxygen; refs. 4, 14, 15, 22), primary adult BM-MSCs cultured in hypoxic conditions (1% oxygen) did not undergo spontaneous in vitro transformation; on the contrary, they showed progressive reduction in the proliferation rate during the culture (Fig. 1B). Moreover, once seeded into scaffolds and implanted subcutaneously in mice, MSCs remained vital even after months, showing the ability to recruit blood vessels within the scaffold, but not to form tumors or to show marks of neoplastic transformation (Fig. 1C).

Figure 1.
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 1.

New genetic platform to study genes responsible for sarcomagenesis. A, MSCs were isolated from the bone marrow of p53KO mice as CD31−CD45−TER119−SCA1+PDGFRα+ and cultured at 1% oxygen. After 7 days in culture, cells formed visible CFU-F colonies. B, growth curve with wild-type (WT) MSCs maintained in culture for fewer than 10 passages or more than 30 passages before day 0 of the proliferation assay. Results are shown as one representative experiment out of two independent biologic replicates. C, scaffolds seeded with wild-type MSCs isolated from bone marrow and grown 7 days in hypoxic conditions. The chart on the left shows the size of the collected scaffolds, whereas the pictures on the right are sections of the scaffolds showing blood vessels, and not transformed mesenchymal cells. n = 6 mice implanted with scaffolds. D, growth curve of wild-type or p53KO MSCs isolated from bone marrow and maintained for more than 30 passages in hypoxic conditions is shown on the left, and focus formation assay (bottom) and growth in anchorage-independent manner (soft agar, top) performed with p53KO MSCs are shown on the right. Results are shown as one representative experiment out of three independent biologic replicates. E, schematic overview of the experimental design. The tumorigenic potential of MSCs cultured in hypoxic conditions was assessed seeding cells into scaffolds and implanting them subcutaneously into mice. Two serial implantations have been performed. F, representative pictures of scaffolds seeded with p53KO MSCs and implanted subcutaneously in mice are shown on the left, and hematoxylin and eosin staining of scaffold sections is shown on the right. Charts below the pictures of the scaffolds represent the size of the scaffolds collected from mice (from the first recipient on the left, as well from the second recipient on the right), compared with the size of the scaffold before its implantation. Top right, blood vessels recruited by cells within the scaffold. Bottom right, nontransformed mesenchymal cells seeded within the scaffold. G, focus formation assay with p53KO MSCs cultured for 1 month or 4 months at 20% oxygen or 1% oxygen. Quantification of transformed foci is shown on the left, and representative pictures are shown on the right. Results are shown as one representative experiment out of two independent biologic replicates. H, focus formation assay performed with p53KO MSCs transduced in vitro with vectors expressing c-Myc, KRASG12V, and IDH2R172K, or silenced with shRNA for Pml, Pten, and Lrf. The charts shown on the left represent the quantification of the observed foci of transformation. n = 3 independent biologic experiments. c.v., crystal violet. *, P < 0.05; **, P < 0.01; t test.

Loss of p53 has been firmly implicated in the pathogenesis of undifferentiated sarcomas in humans (23). We therefore assessed the impact of p53 inactivation in our model system. Different from wild-type MSCs, primary Trp53KO (p53KO) adult MSCs maintained in vitro in hypoxic conditions were characterized by a high proliferation rate even after numerous passages, as evidence of a status of immortalization (Fig. 1D). Surprisingly, however, p53KO MSCs did not show signs of neoplastic transformation in hypoxic growth conditions in vitro, such as the ability to form foci of transformation in the dedicated assay or sizable colonies in soft agar (Fig. 1D). To test their tumorigenic potential in vivo, we next seeded p53KO MSCs into scaffolds (24) and transplanted them subcutaneously in syngeneic C57BL/6 or nude mice (first recipients). Two months after the implantation, the scaffolds were collected, cells within them were expanded in hypoxic conditions, and were then used for a second round of implantation (second recipients; Fig. 1E). Similar to wild-type MSCs, p53KO MSCs remained vital within scaffolds. They recruited blood vessels, and they did not show any signs of neoplastic transformation in either first and second recipients, which resulted in the inability to generate tumors in serially transplanted animals (Fig. 1F).

Previously published data reported spontaneous transformation of murine MSCs cultured in regular oxygen conditions after several passages (14, 15). We therefore analyzed the spontaneous transformation of p53KO MSC populations, culturing them for 1 month or 4 months in low (1%) or high (20%) oxygen tension, and then performed a focus formation assay. As shown in Fig. 1G, cells cultured for 1 month at 1% oxygen were not able to generate transformed foci, whereas, on the contrary, cells kept at 20% oxygen formed several foci of transformation, which increased in number and size during the culture. Importantly, we also noticed that MSC cultures kept at 20% oxygen showed a significant increase in the number of cells characterized by several (n > 5) nuclear dots of γH2AX, in comparison with the same cells kept at 1% oxygen (Supplementary Fig. S1A), thus defining a condition of increased DNA damage linked to the 20% oxygen condition, the primary cause of genomic instability in replicating cells (25).

Overall, these data led us to hypothesize that loss of p53 functions in human MSCs (hMSC) may be necessary but not sufficient to trigger sarcomagenesis. In addition, in vitro hypoxic growth conditions, by maintaining genomic stability of primary adult p53-null MSCs and by preventing their spontaneous neoplastic transformation, might represent the cornerstone for the development of a tightly controlled genetic platform aimed at identifying specific genetic alterations that, in combination with p53 loss, could dictate adult MSC transformation and development of undifferentiated sarcomas. To test this hypothesis, we decided to challenge our platform with oncogenic stresses previously implicated in sarcomagenesis, and assess their capacity to transform p53-null MSCs. Specifically, in p53-null MSCs maintained in hypoxic conditions, we overexpressed c-MYC (26), KRASG12V (27), and IDH2R172K (13), whereas we knocked down PTEN (28). The expression of c-MYC and KRASG12V, as well as the loss of PTEN (but not the expression of IDH2R172K), was indeed able to trigger p53-null MSC transformation in vitro and represented proofs of principle for the validity of our approach (Fig. 1H and Supplementary Fig. S1B–S1G).

Identification of Novel Genes Involved in Sarcomagenesis through the MSC-Derived Platform

We next tested whether this new platform would be useful in identifying new genes implicated in sarcomagenesis. Because undifferentiated sarcomas have been suggested to originate through the combined deregulation in adult MSCs of genes involved in cellular proliferation/apoptosis (such as p53), and genes implicated in the regulation of stem cell differentiation (29, 30), we decided to couple two known regulators of stem cell maintenance and differentiation with the loss of p53. The regulators enrolled in the platform were PML (31) and LRF/Pokemon [encoded by the gene ZBTB7A (Zinc finger and BTB domain-containing protein 7A)], which is emerging as one of the master regulators of differentiation for both hematopoietic and nonhematopoietic stem/progenitor cells, and has been attributed oncogenic or tumor-suppressive functions, depending on the specific cellular context (32). Although PML knockdown in p53-null MSCs did not trigger neoplastic transformation, adult p53-null MSCs knocked down for LRF showed features of neoplastic transformation in vitro (Fig. 1H and Supplementary Fig. S1F–S1G), suggesting a possible role for LRF as a suppressor of sarcomagenesis. To fully determine this new role of LRF/Pokemon in sarcomagenesis, we generated a cohort of p53KOZbtb7aF/F mice and derived adult MSCs as previously described (Fig. 1A). Zbtb7a was knocked out in vitro by transducing p53KOZbtb7aF/F MSCs with lentiviral vectors containing CRE cDNA, or an empty vector as control (hereafter referred to as p53KOZbtb7aF/F-CRE or p53KOZbtb7aF/F-CTR for brevity; Supplementary Fig. S2A). Although p53KOZbtb7aF/F-CRE and p53KOZbtb7aF/F-CTR cells showed similar anchorage-dependent growth rates (Supplementary Fig. S2B), the anchorage-independent colony-forming capacity of p53KOZbtb7aF/F-CRE cells, as well as the capacity to form transformation foci in vitro, was significantly higher than that of p53KOZbtb7aF/F-CTR cells (Fig. 2A and data not shown). Off-target effects of the CRE infection were ruled out upon transduction of p53KOZbtb7a+/+ cells with the same lentiviral vectors containing CRE cDNA, or an empty vector as control used in p53KOZbtb7aF/F cells, and then performing a focus formation assay (Supplementary Fig. S2C).

Figure 2.
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 2.

LRF loss in MSCs leads to formation of mesenchymal tumors. A, soft-agar assay for detecting anchorage-independent cell growth of p53KOZbtb7aF/F-CTR and p53KOZbtb7aF/F-CRE MSCs. Representative pictures of the colonies are shown on the left, and the quantification on the right is shown as average of three biologic independent replicates ± SEM. B, schematic overview of the experimental design is shown on the left, and the percentage of mice with a tumor bigger that 0.5 cm3 is shown on the right. p53KOZbtb7aF/F-CTR cells were not transformed, and only scaffolds with mesenchymal cells were recovered after transplantation (n = 2 CTR; n = 2 CRE). C, detection of the transformation status of p53KOZbtb7aF/F-CTR or p53KOZbtb7aF/F-CRE cells. Pictures of the foci are shown on the left, and the quantification of the transformed foci is shown on the right. The quantification on the right is shown as pooled from three independent experiments, mean ± SEM. D, tumors generated by p53KOZbtb7aF/F-CTR or p53KOZbtb7aF/F-CRE cells transplanted within scaffolds into second recipient mice. Representative pictures of mice are shown on the left, and the percentage of mice with a tumor bigger than 0.5 cm3 (scaffold size used as control) is shown on the right (n = 4 CTR; n = 7 CRE). E, sizes of tumors generated by p53KOZbtb7aF/F-CTR or p53KOZbtb7aF/F-CRE cells transplanted within scaffolds into second recipient mice. Pictures of the collected tumors are shown on the left, and the relative size of tumors is shown on the right (scaffold size used as control). F and G, tumors generated by p53KOZbtb7aF/F-CRE cells were compared with p53KOZbtb7aF/F-CTR cells collected from first recipients, seeded into scaffolds, and then transplanted into second recipients. Hematoxylin and eosin staining showing the morphology of collected tumors or mesenchymal cells on top of the scaffold. p53KOZbtb7aF/F-CTR cells were not able to generate tumors in vivo, and only scaffolds with mesenchymal cells were recovered after transplantation, whereas p53KOZbtb7aF/F-CRE cells originated undifferentiated sarcomas. (*, scaffold; scale bars, 20 μm). H, LRF expression in human undifferentiated sarcomas. (scale bars, 30 μm). **, P < 0.01; ***, P < 0.001; t test.

Finally, to test their tumorigenic potential in vivo, we seeded p53KOZbtb7aF/F-CRE or p53KOZbtb7aF/F-CTR MSCs into the scaffolds and implanted them into mice following the same protocol described in Fig. 1E. Two months after implantation, we observed that p53KOZbtb7aF/F-CTR cells were not able to generate tumors in mice (as expected, only nontransformed mesenchymal cells were recovered from the scaffolds), whereas the p53KOZbtb7aF/F-CRE cells underwent neoplastic transformation and generated tumors in all the transplanted mice (Fig. 2B). Cells were then recovered from the scaffolds, characterized for LRF expression (Supplementary Fig. S2D), and further tested for their neoplastic potential in vitro, and then in vivo in a second round of transplantation. Once again, p53KOZbtb7aF/F-CRE and p53KOZbtb7aF/F-CTR cells recovered from the scaffold showed similar rates of anchorage-dependent proliferation (Supplementary Fig. S2E), but only the p53KOZbtb7aF/F-CRE cells displayed the capacity to form transformed foci (Fig. 2C). Importantly, once retransplanted in secondary recipients (second recipients), p53KOZbtb7aF/F-CRE cells originated tumors larger than 5 mm in less than 2 weeks (7 of 7 mice; 2 nude mice and 5 C57Bl/6), whereas none of the 4 mice (2 nude mice and 2 C57BL/6) retransplanted with p53KOZbtb7aF/F-CTR cells originated tumors (Fig. 2D–G). Histopathologic analysis of scaffolds recovered from mice revealed that p53KOZbtb7aF/F-CRE cells originated undifferentiated sarcomas, which were able to egress the scaffolds and to invade tissues nearby. On the contrary, only nontransformed mesenchymal cells were present in the scaffolds implanted with p53KOZbtb7aF/F-CTR cells (Fig. 2F and G).

Because our platform identified Lrf as a tumor-suppressor gene in triggering the transformation of MSCs, we investigated the expression of LRF through immunohistochemistry analyses on a comprehensive human tissue microarray (TMA) containing 45 undifferentiated mesenchymal tumors [fibrosarcomas (F.) and 20 malignant fibrous histiocytomas (M.F.H.)], compared with 4 normal fibrous tissues (N.F.T.; Fig. 2H). All normal fibrous tissues (4 of 4) as well as human adult MSCs (Supplementary Fig. S2F) were characterized by LRF expression, whereas, in sharp contrast, malignant undifferentiated sarcomas were strongly negative (41 of 45 cases of fibrosarcomas and 19 of 20 cases of malignant fibrous histiocytomas).

Overall, these results demonstrate that our platform may be an important tool to identify new oncogenes and tumor suppressors involved in the development of human sarcomas.

LRF Is Essential for MSC Commitment and Differentiation

We next investigated the biologic processes through which LRF loss could trigger sarcomagenesis. LRF/Pokemon has been described in the stemness maintenance/differentiation in different cell lineages (32); however, nothing is known about its role in adult MSCs. For this reason, we first investigated the possibility that LRF could trigger sarcomagenesis by blocking the differentiation capacity of MSCs. Accordingly, we derived MSCs from Zbtb7a-floxed mice (Zbtb7aF/F) and investigated their commitment/differentiation ability toward osteoblasts, chondrocytes, and adipocytes upon LRF knockout in vitro through transduction with CRE-lentiviral vector (hereafter referred to as CRE cells or CTR cells). Despite the profound reduction of Lrf expression (Supplementary Fig. S3A), CRE cells remained similar to CTR cells in terms of morphology, size, and number of the CFU-F colonies generated (Supplementary Fig. S3B), as well as in numbers of cells undergoing senescence (Supplementary Fig. S3C) or apoptosis (Supplementary Fig. S3D and S3E). However, as shown in Fig. 3A–E, CRE cells displayed differentiation defects when compared with CTR cells. CRE cells generated only 30% of the Oil-Red-O–positive CFU-F colonies generated by CTR cells in response to adipogenic induction (Fig. 3A), and, accordingly, the expression of Pparg and Fabp4 during differentiation was significantly lower in CRE cells than in CTR cells (Fig. 3B). Similarly, CRE cells treated with osteogenic-stimulating factors originated fewer ALP+ osteoblasts than CTR cells (Fig. 3C), and CRE cells expressed lower levels of Alp and osteocalcin (Oc) mRNAs compared with controls (Fig. 3D). Finally, regarding chondrogenesis, CRE cells originated chondrocyte micromasses surrounded by less extracellular matrix (as shown by Toluidine blue staining) than CTR cells. Interestingly, CRE cells expressed significantly higher amounts of Col2 in comparison with CTR cells, although the expression of markers of terminal differentiation, such as Col9 and Col10, was significantly reduced, suggesting that chondrocyte progenitors are favored in their initial commitment, yet they fail to reach a mature terminal differentiation (Fig. 3E).

Figure 3.
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 3.

LRF is a key factor for MSC commitment and differentiation. A, MSC differentiation into mature adipocytes. Adipocytic colonies stained with Oil-Red-O are shown on the left, and the relative quantification of adipocytic colonies (positive for Oil-Red-O) among the total number of colonies (CFU-F) is shown on the right. The quantification on the right is shown as average of five independent experiments ± SEM. B, Lrf, Pparg, and Fabp4relative mRNA expression in CTR cells and CRE cells during adipogenesis. Results are shown as one representative experiment out of two independent biologic replicates. C, MSC differentiation toward mature osteoblasts. Representative pictures of ALP+ cells are shown on the left, and the relative number of ALP+ cells is shown on the right. The quantification on the right is the average of three independent experiments ± SEM. D, Lrf, Alp, and Oc relative mRNA expression in CTR cells and CRE cells during osteogenesis. Results are shown as one representative experiment out of two independent biologic replicates. E, MSC differentiation toward chondrocytes. Representative images of chondrocytes originated from CTR cells and CRE cells stained with Toluidine blue are shown on the left (n = 2 independent biologic replicates). Relative mRNA expression levels of Lrf, Col2, Col9, and Col10 are shown on the right. Results are shown as average of two independent biologic replicates ± SEM. F, morphology of hMSCs transduced with shCTR or shLRF and cultured at 1% of oxygen. G, hMSCs transduced with shCTR or shLRF and induced to undergo adipogenesis, at day 7 of the differentiation process. Magnification shows in detail fully differentiated adipocytes. H, hMSC differentiation into adipocytes, at day 15 of the differentiation process. Adipocytes stained with Oil-Red-O are shown on top, and the relative mRNA expression of FABP4 is shown in the graph. *, P < 0.05; **, P < 0.01; ***, P < 0.001; t test.

Finally, to corroborate our findings in hMSCs, LRF was knocked down through specific shRNAs, taking advantage of commercially available hMSCs cultured under the same conditions used for mouse MSCs. The ability of shLRF and shCTR hMSCs to originate mature adipocytes was evaluated as previously described for mouse MSCs. Both shLRF-and shCTR-transduced hMSCs behaved comparably in culture, without displaying features of apoptosis or senescence (Fig. 3F). However, although shCTR-hMSCs showed initial signs of adipocytic differentiation starting from day 7 (Fig. 3G) and were fully differentiated at day 15 (Fig. 3H), shLRF-hMSCs remained completely undifferentiated at day 7 (Fig. 3G) and generated only a few mature cells at day 15. Accordingly, expression levels of FABP4 were reduced in shLRF-hMSCs compared with shCTR-hMSCs (Fig. 3H). Analysis of hMSCs therefore confirms the results obtained in mouse MSCs, as well as the evolutionary conserved critical role for LRF in determining MSCs' cell-fate decisions.

LRF Promotes MSC Commitment through the Transcriptional Repression of DLK1

On the basis of these data showing that LRF/Pokemon governs the commitment capacity of MSCs, and having excluded a possible role of two well-characterized pathways regulated by LRF/Pokemon, ARF (33) and NOTCH1 (34), in this process (data not shown), we aimed to understand which pathways are regulated by LRF in MSCs, to identify possible new players involved in the genesis of undifferentiated sarcoma and, in turn, potential targets for therapy. Considering that oncogenic and tumor-suppressive pathways are often wired to regulate cell-lineage commitment and differentiation in physiologic conditions (35), we focused our attention on the DLK1 (Delta-like-1)–SOX9 [SRY (sex determining region Y)-box 9] pathway, which is known to be critical in the determination of mesenchymal lineages (36–40). In particular, we focused on SOX9, as it has been shown to be involved in the differentiation process of MSCs (41), in addition to being recently described as functionally antagonized by LRF in prostate tumorigenesis (42, 43). CTR cells and CRE cells were first analyzed by RT-qPCR for the expression of SOX9 transcriptional target genes (44, 45); both genes were overexpressed in CRE cells as compared with CTR cells (Fig. 4A). Similarly, the knockdown of LRF in hMSCs resulted in the upregulation of SOX9 activity (Fig. 4B). Next, to address the critical question of whether LRF mediates MSC commitment through SOX9, CRE cells were knocked down for SOX9 (Supplementary Fig. S4A) and induced to differentiate. CTR-shSCR cells, CRE-shSCR cells, and CRE-shSox9 cells originated a comparable number of colonies as detected by crystal violet, whereas downregulation of SOX9 levels and activity did not rescue the capacity of CRE cells to differentiate into mature adipocytes (Fig. 4C and Supplementary Fig. S4B and S4C). Similarly, downregulation of SOX9 in CRE cells negligibly rescued the ability of MSCs to differentiate into mature osteoblasts (Fig. 4D).

Figure 4.
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 4.

LRF regulates the differentiation process of MSCs through the repression of DLK1. A, relative mRNA expression levels of Lrf, Mia, and Col2a2 in CTR cells and CRE cells. Results are shown as one representative experiment out of two independent biologic replicates. B, relative mRNA expression levels of LRF, H19, and MIA in hMSCs transduced with shCTR or shLRF. C, adipogenesis potential of CTR-shSCR cells, CRE-shSCR cells, and CRE-shSox9 cells. Adipocytic colonies stained with Oil-Red-O (top) or crystal violet (bottom) are shown on the left, and the relative quantification of adipocytic colonies is shown on the right. The quantification on the right is presented as average of three independent experiments ± SEM. D, osteogenesis potential of CTR-shSCR cells, CRE-shSCR cells, and CRE-shSox9 cells. Representative pictures of ALP staining are shown on the left, whereas the relative numbers of ALP+ cells are shown on the right. The quantification on the right is presented as average of three independent experiments ± SEM. E, Lrf and Dlk1 relative mRNA expression in CTR cells and CRE cells. Results are shown as average of five biologic independent replicates ± SEM. F, relative mRNA expression levels of LRF and DLK1 in hMSCs transduced with shCTR or shLRF. G, luciferase assay for detecting the activity of LRF on the Dlk1 promoter. Results are shown as average of three biologic independent replicates ± SEM. H, EMSA assay showing a shift in the presence of a specific probe representative for binding site 4 and a supershift in the presence of anti-LRF antibody. I, ChIP of the LRF at the Dlk1 promoter region. Results are shown as average of three biologic independent replicates ± SEM. J, adipogenesis potential of CTR-shSCR cells, CRE-shSCR cells, and CRE-shDlk1 cells. Adipocytic colonies stained with Oil-Red-O (top) or crystal violet (bottom) are shown on the left, and the relative quantification of adipocytic colonies is shown on the right. The quantification on the right is presented as average of three biologic independent replicates ± SEM. K, relative mRNA expression levels of Pparg and Fabp4 in adipocytes derived from CTR-shSCR cells, CRE-shSCR cells, and CRE-shDlk1 cells. Results are shown as average of three biologic independent replicates ± SEM. L, osteogenesis potential of CTR-shSCR cells, CRE-shSCR cells, and CRE-shDlk1 cells. Representative pictures of ALP staining are shown on the left, and the relative number of ALP+ cells is shown on the right. The quantification on the right is presented as the average of three biologic independent replicates ± SEM. M, Alp and Oc relative mRNA expression in osteoblasts derived from CTR-shSCR cells, CRE-shSCR cells, and CRE-shDlk1 cells. Results are shown as average of three biologic independent replicates ± SEM. *, P < 0.05; **, P < 0.01; ***, P < 0.001; t test.

Another critical regulator of MSC commitment is DLK1 (46–50). We therefore decided to investigate the possibility that LRF could regulate DLK1 activity, and through it the commitment of MSCs. Intriguingly, CRE cells showed a significant increase in Dlk1 expression compared with CTR cells (Fig. 4E). Similarly, knockdown of LRF resulted in the upregulation of DLK1 in hMSCs (Fig. 4F). To determine whether LRF could directly regulate DLK1 expression, we cloned the Dlk1 promoter sequence into a luciferase construct and performed in vitro transactivation assays. This analysis revealed that LRF efficiently repressed the basal promoter activity in a dose-dependent manner (Fig. 4G), and, among the six putative LRF consensus regions within the promoter of Dlk1, we discovered that only the two consensus sequences (indicated as 4 and 5 in Supplementary Fig. S4D) closest to the transcriptional starting site were necessary for LRF repression of Dlk1 transcription. In addition, the ability of LRF to bind the Dlk1 promoter was confirmed by performing electrophoretic mobility shift assays (EMSA; Fig. 4H) and chromatin immunoprecipitation (ChIP; Fig. 4I) in the 3T3L1 mouse mesenchymal cell line. To functionally validate the LRF–DLK1 axis in MSC commitment, we knocked down DLK1 in CRE cells and induced the generated cells to differentiate toward adipocytes and osteoblasts. As expected, CRE-shSCR cells failed to differentiate compared with CTR-shSCR cells; but, critically, the concomitant inactivation of DLK1 (CRE-shDlk1 cells) rescued their defects of adipogenesis (Fig. 4J and K and Supplementary Fig. S4E and S4F) and osteogenesis (Fig. 4L and M).

LRF Acts as an Oncosuppressor of Mesenchymal Tumorigenesis by Controlling the Activity of DLK1 and SOX9

Both DLK1 and SOX9 have been described as oncogenes in several tumor types (36–39). Because we have demonstrated that LRF negatively controls both the expression of DLK1 and the activity of SOX9 in primary nontransformed MSCs, and that, in p53-null MSCs, Lrf acts as a tumor-suppressor gene, we next used our platform to investigate the possibility that DLK1 and SOX9 deregulation might be responsible for transformation of MSCs and sarcomagenesis after LRF loss. p53KOZbtb7aF/F-CRE cells or p53KOZbtb7aF/F-CTR cells collected from scaffolds (first recipient) were grown in hypoxia for 7 days and then transduced with shRNA to silence Dlk1 or Sox9. Four different cellular types were then obtained: p53KOZbtb7aF/F-CTR-shSCR, p53KOZbtb7aF/F-CRE-shSCR, p53KOZbtb7aF/F-CRE-shDlk1, and p53KOZbtb7aF/F-CRE-shSox9 (in the figures indicated only as CTR-shSCR, CRE-shSCR, CRE-shDlk1, and CRE-shSox9 for brevity; Fig. 5A and Supplementary Fig. S5A and S5B). Cells were then used in both in vitro and in vivo experiments to test their tumorigenic potential. In an anchorage-dependent proliferation assay, all the cell types showed similar division rates (Fig. 5A), but their capacity to form transformed foci in culture was significantly different. Although p53KOZbtb7aF/F-CRE-shSCR cells were extremely prone to form foci of transformation, downregulation of Dlk1 (p53KOZbtb7aF/F-CRE-shDlk1) or Sox9 (p53KOZbtb7aF/F-CRE-shSox9) in p53KOZbtb7aF/F-CRE cells significantly limited their oncogenic potential in vitro (Fig. 5B and Supplementary Fig. S5C). To analyze in vivo the possible implications of DLK1 and SOX9 hyperactivity in the tumorigenic process induced by the absence of LRF, we transplanted scaffolds containing CTR-shSCR, CRE-shSCR, CRE-shDlk1, or CRE-shSox9 cells subcutaneously in the flank of recipient mice, and then evaluated their tumorigenic potential. One month after implantation, 4 of 4 mice implanted with scaffolds containing p53KOZbtb7aF/F-CRE-shSCR cells, 4 of 5 mice implanted with scaffolds containing p53KOZbtb7aF/F-CRE-shDlk1 cells, and 3 of 5 mice implanted with scaffolds containing p53KOZbtb7aF/F-CRE-shSox9 cells developed visible tumors, whereas no tumors were observed in mice implanted with scaffolds containing p53KOZbtb7aF/F-CTR-shSCR cells (0/4; Fig. 5C). Although 80% of mice implanted with p53KOZbtb7aF/F-CRE-shDlk1 and 60% of mice implanted with p53KOZbtb7aF/F-CRE-shSox9 MSCs developed tumors, these lesions were significantly smaller than the p53KOZbtb7aF/F-CRE-shSCR tumors (Fig. 5D), and only a few transformed multinucleated cells were present within the scaffolds containing p53KOZbtb7aF/F-CRE-shDlk1 cells or p53KOZbtb7aF/F-CRE-shSox9 cells (Fig. 5E), revealing that both of these two oncogenes participate in undifferentiated sarcoma formation from MSCs.

Figure 5.
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 5.

LRF plays a role as an oncosuppressor gene in mesenchymal tumors through DLK1 and SOX9. A, schematic overview of the experimental design is depicted on the left, and the growth curve of p53KOZbtb7aF/F-CTR-shSCR, p53KOZbtb7aF/F-CRE-shSCR, p53KOZbtb7aF/F-CRE-shDlk1, and p53KOZbtb7aF/F-CRE-shSox9 cells is shown on the right. Data show one representative experiment out of three independent biologic replicates. B, detection of transformation status of p53KOZbtb7aF/F-CTR-shSCR, p53KOZbtb7aF/F-CRE-shSCR, p53KOZbtb7aF/F-CRE-shDlk1, and p53KOZbtb7aF/F-CRE-shSox9 cells. Pictures of the transformed foci are shown on the left, and their quantification on the right is presented as average of three biologic independent replicates ± SEM. C, experimental design for in vivo sarcomagenesis is shown in the left, and the percentage of mice with tumor is shown on the right. D, representative pictures of tumors generated by p53KOZbtb7aF/F-CTR-shSCR, p53KOZbtb7aF/F-CRE-shSCR, p53KOZbtb7aF/F-CRE-shDlk1, and p53KOZbtb7aF/F-CRE-shSox9 cells implanted within scaffolds into recipient mice (n = 4 CTR-shSCR; n = 4 CRE-shSCR; n = 5 CRE-shDlk1; n = 5 CRE-shSox9) are shown on the left, and the relative size of tumors is shown on the right (scaffold size used as control). E, representative hematoxylin and eosin staining showing the morphology of collected tumors or mesenchymal cells on top of the scaffold. p53KOZbtb7aF/F-CTR cells were not able to generate tumors in vivo and only scaffolds with mesenchymal cells were recovered after transplantation, whereas p53KOZbtb7aF/F-CRE cells, p53KOZbtb7aF/F-CRE-shDlk1, and p53KOZbtb7aF/F-CRE-shSox9 cells originated undifferentiated sarcomas (*, the scaffold; scale bars, 20 μm). F, schematic overview of the genetic platform for discovering new oncopathways involved within the sarcomagenesis process and new targeted therapies. G, schematic overview of LRF involvement as a tumor-suppressor gene in undifferentiated sarcomas. The LRF–DLK1 and LRF–SOX9 pathways are examples of results obtained with the application of the genetic platform. *, P < 0.05; ***, P < 0.001; t test.

Discussion

Adult MSCs have been proposed as the cell of origin of human undifferentiated sarcomas, one of the most aggressive and lethal soft-tissue tumors (4–8). However, a comprehensive analysis of the molecular mechanisms dictating the onset and progression of undifferentiated sarcomas is still missing, consequently limiting the generation of preclinical models faithfully recapitulating the human disease and, more importantly, the development of new and effective therapeutic options for this lethal tumor. A major current hurdle in studying and modeling the pathogenesis of sarcoma is represented by the need to deliver the appropriate genetic perturbation(s) to a specific putative cell of origin (19). Here, we used primary adult mouse bone marrow MSCs sorted according to the expression of specific markers and tested for stemness potential. By modifying their culturing condition, we have developed a new experimental ex vivo/in vivo platform to deconstruct the molecular genetics underlying the pathogenesis of undifferentiated sarcomas. Comparable findings were obtained using commercially available unsorted hMSCs. It must be noted, however, that recent reports question the use of unsorted hMSCs collected from bone marrow and selected solely on their ability to adhere to culture dishes for their inherent heterogeneity (3). Our approach nevertheless rests on the discovery that culturing mouse MSCs and hMSCs in hypoxic conditions prevents their spontaneous propensity to transform. As we recently reported, MSCs reside in bone marrow areas characterized by low oxygen concentration. Compared with other stromal cells within the endosteal bone marrow, MSCs express higher levels of hypoxia-inducible factor-1α (HIF1a) and HIF2a transcripts, showing a distinctive hypoxic profile (21). Therefore, the enforced switch from an anaerobic to an aerobic environment due to culturing in a 20% oxygen condition could determine excessive levels of reactive oxygen species (ROS) and, in turn, an increasing amount of unrepaired DNA damage, a prelude to genetic instability and neoplastic transformation. By preventing the spontaneous transformation of wild-type as well as p53-null MSCs, this new approach will turn out to be very useful to (i) quickly assess the relevance of specific genetic alterations within the tumorigenesis process of MSCs; (ii) characterize oncogenic or oncosuppressive functions and molecular pathways controlled by the newly identified genetic alterations; and (iii) evaluate, preclinically, both in vitro and in vivo (in mice implanted with scaffolds), the efficacy of novel targeted therapies toward the eradication of this lethal disease (Fig. 5F). The relevance of this new approach is based on its ability to control the cell of origin of the disease, its simplicity, and velocity. Furthermore, it can easily be coupled with the use of shRNA/overexpressing vectors/libraries in vitro, or the new developing system CRISPR/Cas9 for genome editing of both coding and noncoding genes to be tested individually or in combination. Importantly, we demonstrate the utility of this discovery platform. Specifically, we have defined a role for LRF as tumor-suppressor gene in adult MSCs and identified LRF as a key factor in the control of the early steps of adult MSC commitment. In addition, we have characterized two evolutionarily conserved oncosuppressive mechanisms regulated by LRF in adult MSCs: its ability to transcriptionally repress DLK1 expression and to inhibit SOX9 activity (Fig. 5G). DLK1 is a transmembrane protein that, once cleaved by the enzyme TACE/ADAM17, releases the soluble factor fetal antigen-1 (FA1; ref. 51). Thus, the use of neutralizing antibodies against DLK1 (52), alone or in combination with inhibitors of SOX9 downstream factors, may offer a window of opportunity for the development of novel therapeutic strategies for this lethal form of cancer.

Methods

Mice

Transgenic Zbtb7afl/fl mice were generated as described previously (34); p53KO mice were purchased from The Jackson Laboratory, and generated as described previously (53). All the experimental animals were kept in a C57Bl/6J pure background. In some specific experiments, immunodeficent mice were used (The Jackson Laboratory; B6.Cg-Foxn1nu/J). Animal experiments were performed in accordance with the guidelines of the Beth Israel Deaconess Medical Center Institutional Animal Care and Use Committee.

Cell Lines and hMSCs

The 3T3-L1 cells were purchased from the ATCC (ATCC-CL-173) and cultured following the vendor's directions. Cell lines were tested for Mycoplasma (MycoAlert; Lonza), but not further authenticated. hMSCs were purchased from Lonza (PT-2501). According to the vendor, cells were positive for CD105, CD166, CD29, and CD44, and tested negative for CD14, CD34, and CD45. Cells were cultured and induced to differentiate following the vendor's directions, but were not further authenticated. Cells were maintained in culture with MSC basal medium (Lonza; PT-3238) supplemented with growth factors (Lonza; PT-3001). During adipogenesis, cells were cultured in adipogenic induction medium (Lonza; PT-3102B), followed by adipogenic maintenance medium (Lonza; PT-3102A), according to the vendor's instructions.

MSC Maintenance

MSCs were derived from C57BL/6 wild-type, Zbtb7aF/F, and p53koZbtb7aF/F mice. Long bones were collected, crushed, and digested with collagenase II (1 mg/mL) for 1-hour shaking at 37°C. Recovered cells were stained and FACS-sorted as CD45−CD31−Ter119−Sca1+PDGFRα+, and cultured at the density of 1,000 cells in a T25 flask. MSCs were cultured using complete MesenCult medium (STEMCELL Technologies) and maintained in a humidified chamber with 5% CO2 and 1% O2; half medium was changed every 3 days. After 7 days in culture at 1% O2, cells formed visible CFU-F colonies; after this point, cells were split once they reached 80% confluence.

MSC Differentiation

MSCs were cultured using complete MesenCult medium (STEMCELL Technologies) and maintained in a humidified chamber with 5% CO2 and 1% O2. For inducing the differentiation, the MesenCult medium was changed with specific medium for each differentiation (see below). During the differentiation process, cells were maintained in regular oxygen concentration, 5% CO2 and 37°C. For adipocyte differentiation, MSC colonies were treated with StemXVivo Osteogenic/Adipogenic medium (R&D Systems; CCM007) plus adipogenic supplements (R&D Systems; CCM011). Medium was changed every other day for 7 days. Mature adipocytes were identified with Oil-Red-O (Sigma) following the manufacturer's procedure. Briefly, Oil-Red-O stock solution was prepared by solubilizing Oil-Red-O powder in isopropanol (0.35 g/100 mL isopropanol), stirring it overnight. Cells were washed once in PBS and then fixed with 10% formalin (Sigma) for 30 minutes at room temperature. The working Oil-Red-O solution was prepared by mixing three parts stock solution with two parts ddH2O. Fixed cells were washed once to remove the formalin with water and then treated for 5 minutes with 60% isopropanol; then they were treated for 5 minutes with the working solution. After the treatment, cells were washed with water to eliminate Oil-Red-O precipitates. For osteocyte differentiation, CFU-F–forming MSCs were collected and replated at a density of 20,000 cells per well in a 12-well plate. Once they reached 40% confluence, cells were treated with StemXVivo Osteogenic/Adipogenic medium (R&D Systems; CCM007) together with osteogenic supplement (R&D Systems; CCM009). Medium was changed every 3 days for 20 days. Mature osteoblasts were stained with a Leukocyte Alkaline Phosphatase kit (Sigma; cat. no. 85L3R) according to the manufacturer's procedures. For chondrocyte differentiation, 150,000 MSCs were pelleted in StemXVivo Chondrogenic medium (R&D Systems; CCM005) with Chondrogenic Supplement (R&D Systems; CCM006). Tubes were then incubated at 37°C and 5% CO2 with loosened cap. Medium was changed every 3 to 4 days for 20 days. Micromasses were then collected, embedded into paraffin, sectioned, and stained with Toluidine blue.

Flow Cytometry

Cells were analyzed using LRSII (BD, Pharmingen) and sorted using FACSARIA II (BD, Pharmingen). The following antibodies were used: anti-CD45 FITC, anti-CD31 FITC, anti-Ter119 FITC, anti-Sca1 Pacific Blue, anti-PDGFRα PE (all purchased from BioLegend), and Annexin V–PE (BD, Pharmingen).

Immunofluorescence

Cells were fixed with 4% paraformaldehyde for 10 minutes, washed with PBS, and permeabilized with PBS, Triton-X100 0.2% for 10 minutes. Blocking before antibodies was performed in PBS, Triton-X100 0.2% and 10% FBS for 30 minutes. Primary antibody p-histone H2AX (Cell Signaling Technology) was incubated overnight in blocking buffer, and an anti-Rabbit-488 was used as secondary antibody.

Immunohistochemistry and Human Tumor Samples

A TMA of human fibrous tissue, fibromas, fibrosarcomas, and malignant fibrous histiocytomas was purchased from US Biomax, Inc. (SO2084). IHC was performed on 5-mm paraffin sections with the avidin–biotin–peroxidase method. The following primary antibody was used: LRF (Bethyl Laboratory; cat. no. A300-549) 1:400 for human staining. Antigen retrieval was performed using citrate buffer. Samples were evaluated assessing the overall positivity of the neoplastic tissue and comparing it with normal fibrous tissue.

Luciferase Assay

One day before transfection, cells were plated into a 24-well plate at a density of 70% to 80%. The cells were transfected with the plasmid DNA (pGl3-Luc-DLK1 promoter and pcDNA3-LRF) and Lipofectamine 2000 (Invitrogen) for 24 hours according to the manufacturer's recommendation. Forty-eight hours after transfection, cells were lysed and analyzed for luciferase activity using the Dual-Luciferase Assay System (Promega). pRL-SV40-Renilla was used a control for transfection efficiency.

EMSA

For EMSA, 3T3L1 cells were resuspended in lysis buffer (10 mmol/L Tris–HCl, pH 7.5, 1 mmol/L EDTA, 0.5% Nonidet P-40, 150 mmol/L NaCl, 1 mmol/L dithiothreitol, 10% glycerol, 0.5 mmol/L phenylmethylsulfonyl fluoride, and protease inhibitors). After 20 minutes on ice, extracts were centrifuged at 16,000 × g for 20 minutes at 4°C to remove cell debris. Protein concentration in supernatants was determined using a Bio-Rad protein assay. A 26-mer DNA oligonucleotide containing the Dlk1 promoter sequence with putative LRF binding site (5′-GGCTCGTCGGAGGGCTTCGGCTTTTC-3′) was end-labeled with 32P [(10 μmol/L oligonucleotide, 1 μL kinase buffer 10 × (40 mmol/L, Tris–HCl pH 7.5, 10mmol/L MgCl2, 5mmol/L dithiothreitol), 2 μL ATP (ATP (ϒ-32P); 5,000Ci/mmol), and 0.5 μL of the kinase (10 U/μL)] and annealed to the complementary strand. For binding reactions, 30 μg of whole-cell extract was added to gel shift buffer [20 mmol/L HEPES pH 8, 25 mmol/L KCl, 0.1 mmol/L EDTA, 2 mmol/L MgCl2, 0.5 mmol/L dithiothreitol, 0.025% Nonidet P-40, 2 mmol/L spermidine, 10% glycerol, 0.1 mg/mL acetylated bovine serum albumin, 120 ng of double-stranded poly(d[I-C])] containing the labeled oligonucleotide in a final volume of 30 μL. Reactions were incubated for 30 minutes at room temperature, and electrophoresed on a nondenaturing 4% polyacrylamide gel before autoradiography. Supershift was obtained by adding 500 ng of anti-LRF antibody (13E9) to the binding reaction.

Chromatin Immunoprecipitation

ChIP was performed as described previously (54) with the Magna ChIP G Chromatin Immunoprecipitation Kit (Millipore) using a hamster monoclonal antibody against Pokemon (LRF; ref. 33). Primer sequences used for PCR were as follows: DLK1_4,5_Fwd: cccagggacaggcagtaaggtt, DLK1_4,5_Rev: ccaaacgcacaccacgaagat. The 3T3L1 cells were cross-linked with formaldehyde for 5 minutes and terminated with 0.125 of mmol/L glycine. Cells were sonicated to generate chromatin with an average size of 500 bp. Monocloncal anti-LRF antibody was first incubated with a hamster bridging antibody (Jackson ImmunoResearch Laboratories), followed by the addition of the 3T3L1 chromatin. Immunoprecipitated chromatin was assayed by quantitative PCR using the DLK1-specific primers.

Viral Vectors

Lentiviral vector expressing CRE, shCTR, and shLRF, and retroviral vectors containing c-Myc and KRASG12V were obtained from Addgene. Viral vectors of control as well as containing shRNA against LRF, PML, PTEN, DLK1, and SOX9 were obtained from Open Biosystems. Vectors containing IDH2R172K were cloned in our laboratory. All the viral particles were produced by transfecting 293T cells with packaging vectors of second generation.

Anchorage-Independent Cell Growth

A soft-agar colony formation assay was carried out by seeding 1 × 104 MSCs in DMEM containing 0.4% low-melting agarose and 10% fetal calf serum (FCS). The cells were then plated in 6-well plates previously coated with DMEM containing 1% of low-melting agarose and 10% FCS. The number of colonies was scored 3 weeks later, and quantification was done using ImageJ.

Focus Formation Assay

MSCs were seeded at a concentration of 1 × 105 cells per well in a 6-well plate and cultured for 10 days in complete medium (DMEM + 10% FBS) at 37°C. After the formed visible foci were fixed with 10% formalin for 30 minutes, they were stained with crystal violet.

In Vivo Sarcomagenesis

As previously described, 3-D scaffolds made with reticulated polycarbonate polyurethane urea matrix (Synthecon) were used (24). Briefly, scaffolds (5 mm × 2 mm) were put into the wells of a 96-well plate and seeded with MSCs at a concentration of 1 × 105 cells per scaffold. Wells were completely filled with 200 μL of complete MesenCult medium and left in culture (in regular oxygen concentration) for at least 6 hours. Scaffolds were washed with PBS to eliminate nonattached cells and implanted subcutaneously into mouse flanks. Recovered scaffolds/tumors were fixed in formalin and embedded into paraffin, sectioned, and then stained with hematoxylin and eosin. Animal experiments were performed in accordance with the guidelines of the Beth Israel Deaconess Medical Center (Boston, MA) Institutional Animal Care and Use Committee. Pathologic analysis of the tumors has been performed at the Dana-Farber Rodent Histopathology Core.

Western Blot Analysis

For Western blot analysis, cell lysates were prepared with RIPA buffer. The following antibodies were used: hamster anti-LRF clone 13E9, rabbit polyclonal anti-cPARP (Cell Signaling Technology; cat no. 9532), mouse polyclonal anti–β-actin (Sigma-Aldrich), and mouse monoclonal anti-HSP90 (BD Biosciences).

Senescence Detection

MSCs were cultured in hypoxia, before and for 4 days after the transduction. After the transduction, cells were collected and seeded 10 × 105 cells per well in a 12-well plate. Cells were then treated with SA-β-galactosidase overnight. Senescence was detected using a senescence detection kit (Calbiochem) following the manufacturer's protocol.

Plasmids

The entire Dlk1 mouse promoter sequence was obtained by PCR from a BAC clone. Fwd (5′ ccgagctcgggagtgccatttcatttaa 3′) and Rev (5′ ccgctagcaaagccagcaggagcaagag 3′) primers were used. The fragment was cloned into a pGL3-Luc enhancer (Promega) in SacI and NheI sites. All the mutants were obtained by using the QuickChange Mutagenesis Kit (Stratagene) and confirmed by sequencing. The mutated version of this plasmid was generated by using the Dlk1 3′-untranslated region (3′-UTR) as template and modifying the putative LRF binding sites using the QuikChange II XL Site-Directed Mutagenesis Kit.

The mutagenic primers used were as follows:

  • site Mutant 1AB forward 5′-ggaagggaaaatggagtctagagacggggagagactcacctcactagtctggg-3′ reverse 5′-ccttcccttttacctcagatctctgcccctctctgagtggagtgatcagaccc-3′;

  • site Mutant 2 forward 5′-gggctcacctcactagtctagagttccttgtactctatgtgcccc-3′ reverse 5′-cccgagtggagtgatcagatctcaaggaacatgagatacacgggg-3′;

  • site Mutant 3 forward 5′-ggagcccttatctcaggaatctagccccaagatcctctc-3′ reverse 5′-cctcgggaatagagtccttagatcggggttctaggagag-3′;

  • site Mutant 4 forward 5′-tgtgccgaaaggtgtgtttgggttagagattcgtggggcaa gtgc-3′ reverse 5′-acacggctttccacacaaacccaatctctaagcaccccgttcacg-3′;

  • site Mutant 5 forward 5′-caatggcaaggctcgtcgaaagacctcggcttttcgtggtggt-3′ reverse 5′-gttaccgttccgagcagctttctggagccgaaaagcaccacca-3′.

RNA Extraction and RT-PCR

Cellular RNA was extracted using Quick-RNA MicroPrep (Zymo Research; R1050) and then retrotranscribed to cDNA using an iScript cDNA Synthesis kit (Bio-Rad; 170-8890). All the analyzed mRNA was detected using TaqMan FAM-conjugated probes (Applied Biosystems). Each target was run in triplicate, and expression level was normalized to mouse β2-microglobulin. Details are provided in Supplementary Experimental Procedures.

TaqMan RT-PCR Probes

All the probes were purchased from Applied Biosystems.

β2-microglobulin: Mm00437764_m1; Sox9: Mm00448840_m1; Mia:Mm00444563_m1; Col2: Mm01309565_m1; Col9: Mm00483836_m1; Col10: Mm00487041_m1; Cebpd: Mm00786711_s1; Runx2:Mm00501584_m1; Fabp4: Mm00445878_m1; Pparg: Mm01184322_m1; Alp: Mm00475834_m1; Osteocalcin (Oc): Mm00649782_gH; Zbtb7a: Mm00657132_m1 and ZBTB7A: Hs00792219_m1; Dlk1: Mm00494477_m1; Hes1: Mm01342805_m1; Hey1: Mm00468865_m1; p21: Mm04205640_g1; MIA: Hs00197954_m1; H19: Hs00262142_g1; LRF: Hs00252415_s1; DLK1: Hs00171584_m1; FABP4: Hs01086177_m1.

Statistical Analysis

Data were analyzed using an unpaired t test (GraphPad Prism; GraphPad Software, Inc.).

Values of P < 0.05 were considered statistically significant (*, P < 0.05; **, P < 0.01; ***, P < 0.001; t test).

Disclosure of Potential Conflicts of Interest

No potential conflicts of interest were disclosed.

Authors' Contributions

Conception and design: J. Guarnerio, L. Riccardi, R. Bernardi, A. Lunardi, P.P. Pandolfi

Development of methodology: J. Guarnerio, L. Riccardi, R. Taulli, T. Maeda, C. Cordon-Cardo

Acquisition of data (provided animals, acquired and managed patients, provided facilities, etc.): J. Guarnerio, R. Taulli, G. Wang, M.S. Song, R.T. Bronson, M. Castillo-Martin, C. Cordon-Cardo

Analysis and interpretation of data (e.g., statistical analysis, biostatistics, computational analysis): J. Guarnerio, R.M. Hobbs, M. Castillo-Martin, C. Cordon-Cardo, A. Lunardi

Writing, review, and/or revision of the manuscript: J. Guarnerio, R.M. Hobbs, C. Cordon-Cardo, A. Lunardi

Administrative, technical, or material support (i.e., reporting or organizing data, constructing databases): J. Guarnerio

Study supervision: A. Lunardi

Other (helped with the experiments): P. Sportoletti

Other (performed pathology): R.T. Bronson

Grant Support

J. Guarnerio has been granted leave of absence from the University Vita-Salute San Raffaele, Milan, and she was funded partially by a fellowship from the University Vita-Salute San Raffaele, and partially by a grant from the Fondazione Cariplo to Rosa Bernardi and Pier Paolo Pandolfi. A. Lunardi has been supported, in part, by a fellowship from the Istituto Toscano Tumori (Italy). R. Taulli has been granted leave of absence from the Department of Oncology, University of Turin School of Medicine. This work has been supported through an NIH grant (R01 CA102142-7) to Pier Paolo Pandolfi.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Acknowledgments

The authors thank Thomas Garvey for insightful editing and all members of the Pandolfi laboratory for critical discussion. The authors also thank Dennis M. Bonal for the IHC staining.

Footnotes

  • Note: Supplementary data for this article are available at Cancer Discovery Online (http://cancerdiscovery.aacrjournals.org/).

  • Received September 5, 2014.
  • Revision received January 12, 2015.
  • Accepted January 14, 2015.
  • ©2015 American Association for Cancer Research.

References

  1. 1.↵
    1. Dean M,
    2. Fojo T,
    3. Bates S
    . Tumour stem cells and drug resistance. Nat Rev Cancer 2005;5:275–84.
    OpenUrlCrossRefPubMed
  2. 2.↵
    1. Uccelli A,
    2. Moretta L,
    3. Pistoia V
    . Mesenchymal stem cells in health and disease. Nat Rev Immunol 2008;8:726–36.
    OpenUrlCrossRefPubMed
  3. 3.↵
    1. Bianco P,
    2. Cao X,
    3. Frenette PS,
    4. Mao JJ,
    5. Robey PG,
    6. Simmons PJ,
    7. et al.
    The meaning, the sense and the significance: translating the science of mesenchymal stem cells into medicine. Nat Med 2013;19:35–42.
    OpenUrlCrossRefPubMed
  4. 4.↵
    1. Tolar J,
    2. Nauta AJ,
    3. Osborn MJ,
    4. Panoskaltsis Mortari A,
    5. McElmurry RT,
    6. et al.
    Sarcoma derived from cultured mesenchymal stem cells. Stem Cells 2007;25:371–9.
    OpenUrlCrossRefPubMed
  5. 5.↵
    1. Choi J,
    2. Curtis SJ,
    3. Roy DM,
    4. Flesken-Nikitin A,
    5. Nikitin AY
    . Local mesenchymal stem/progenitor cells are a preferential target for initiation of adult soft tissue sarcomas associated with p53 and Rb deficiency. Am J Pathol 2010;177:2645–58.
    OpenUrlCrossRefPubMed
  6. 6.↵
    1. Rubio R,
    2. Garcia-Castro J,
    3. Gutierrez-Aranda I,
    4. Paramio J,
    5. Santos M,
    6. Catalina P,
    7. et al.
    Deficiency in p53 but not retinoblastoma induces the transformation of mesenchymal stem cells in vitro and initiates leiomyosarcoma in vivo . Cancer Res 2010;70:4185–94.
    OpenUrlAbstract/FREE Full Text
  7. 7.↵
    1. Mohseny AB,
    2. Hogendoorn PC
    . Concise review: mesenchymal tumors: when stem cells go mad. Stem Cells 2011;29:397–403.
    OpenUrlCrossRefPubMed
  8. 8.↵
    1. Rodriguez R,
    2. Rubio R,
    3. Menendez P
    . Modeling sarcomagenesis using multipotent mesenchymal stem cells. Cell Res 2012;22:62–77.
    OpenUrlCrossRefPubMed
  9. 9.↵
    1. Lin PP,
    2. Pandey MK,
    3. Jin F,
    4. Raymond AK,
    5. Akiyama H,
    6. Lozano G
    . Targeted mutation of p53 and Rb in mesenchymal cells of the limb bud produces sarcomas in mice. Carcinogenesis 2009;30:1789–95.
    OpenUrlAbstract/FREE Full Text
  10. 10.↵
    1. Walkley CR,
    2. Qudsi R,
    3. Sankaran VG,
    4. Perry JA,
    5. Gostissa M,
    6. Roth SI,
    7. et al.
    Conditional mouse osteosarcoma, dependent on p53 loss and potentiated by loss of Rb, mimics the human disease. Genes Dev 2008;22:1662–76.
    OpenUrlAbstract/FREE Full Text
  11. 11.↵
    1. Calo E,
    2. Quintero-Estades JA,
    3. Danielian PS,
    4. Nedelcu S,
    5. Berman SD,
    6. Lees JA
    . Rb regulates fate choice and lineage commitment in vivo . Nature 2010;466:1110–4.
    OpenUrlCrossRefPubMed
  12. 12.↵
    1. Tao J,
    2. Jiang MM,
    3. Jiang L,
    4. Salvo JS,
    5. Zeng HC,
    6. Dawson B,
    7. et al.
    Notch activation as a driver of osteogenic sarcoma. Cancer Cell 2014;26:390–401.
    OpenUrlPubMed
  13. 13.↵
    1. Lu C,
    2. Venneti S,
    3. Akalin A,
    4. Fang F,
    5. Ward PS,
    6. Dematteo RG,
    7. et al.
    Induction of sarcomas by mutant IDH2. Genes Dev 2013;27:1986–98.
    OpenUrlAbstract/FREE Full Text
  14. 14.↵
    1. Miura M,
    2. Miura Y,
    3. Padilla-Nash HM,
    4. Molinolo AA,
    5. Fu B,
    6. Patel V,
    7. et al.
    Accumulated chromosomal instability in murine bone marrow mesenchymal stem cells leads to malignant transformation. Stem Cells 2006;24:1095–103.
    OpenUrlCrossRefPubMed
  15. 15.↵
    1. Wang Y,
    2. Huso DL,
    3. Harrington J,
    4. Kellner J,
    5. Jeong DK,
    6. Turney J,
    7. et al.
    Outgrowth of a transformed cell population derived from normal human BM mesenchymal stem cell culture. Cytotherapy 2005;7:509–19.
    OpenUrlCrossRefPubMed
  16. 16.↵
    1. Funes JM,
    2. Quintero M,
    3. Henderson S,
    4. Martinez D,
    5. Qureshi U,
    6. Westwood C,
    7. et al.
    Transformation of human mesenchymal stem cells increases their dependency on oxidative phosphorylation for energy production. Proc Natl Acad Sci U S A 2007;104:6223–8.
    OpenUrlAbstract/FREE Full Text
  17. 17.↵
    1. Rodriguez R,
    2. Tornin J,
    3. Suarez C,
    4. Astudillo A,
    5. Rubio R,
    6. Yauk C,
    7. et al.
    Expression of FUS-CHOP fusion protein in immortalized/transformed human mesenchymal stem cells drives mixoid liposarcoma formation. Stem Cells 2013;31:2061–72.
    OpenUrlCrossRefPubMed
  18. 18.↵
    1. Frenette PS,
    2. Pinho S,
    3. Lucas D,
    4. Scheiermann C
    . Mesenchymal stem cell: keystone of the hematopoietic stem cell niche and a stepping-stone for regenerative medicine. Annu Rev Immunol 2013;31:285–316.
    OpenUrlCrossRefPubMed
  19. 19.↵
    1. Matushansky I,
    2. Hernando E,
    3. Socci ND,
    4. Mills JE,
    5. Matos TA,
    6. Edgar MA,
    7. et al.
    Derivation of sarcomas from mesenchymal stem cells via inactivation of the Wnt pathway. J Clin Invest 2007;117:3248–57.
    OpenUrlCrossRefPubMed
  20. 20.↵
    1. Morikawa S,
    2. Mabuchi Y,
    3. Kubota Y,
    4. Nagai Y,
    5. Niibe K,
    6. Hiratsu E,
    7. et al.
    Prospective identification, isolation, and systemic transplantation of multipotent mesenchymal stem cells in murine bone marrow. J Exp Med 2009;206:2483–96.
    OpenUrlAbstract/FREE Full Text
  21. 21.↵
    1. Guarnerio J,
    2. Coltella N,
    3. Ala U,
    4. Tonon G,
    5. Pandolfi PP,
    6. Bernardi R
    . Bone marrow endosteal mesenchymal progenitors depend on HIF factors for maintenance and regulation of hematopoiesis. Stem Cell Reports 2014;2:794–809.
    OpenUrlPubMed
  22. 22.↵
    1. Zhou YF,
    2. Bosch-Marce M,
    3. Okuyama H,
    4. Krishnamachary B,
    5. Kimura H,
    6. Zhang L,
    7. et al.
    Spontaneous transformation of cultured mouse bone marrow–derived stromal cells. Cancer Res 2006;66:10849–54.
    OpenUrlAbstract/FREE Full Text
  23. 23.↵
    1. Xiao W,
    2. Mohseny AB,
    3. Hogendoorn PC,
    4. Cleton-Jansen AM
    . Mesenchymal stem cell transformation and sarcoma genesis. Clin Sarcoma Res 2013;3:10.
    OpenUrlPubMed
  24. 24.↵
    1. Vaiselbuh SR,
    2. Edelman M,
    3. Lipton JM,
    4. Liu JM
    . Ectopic human mesenchymal stem cell-coated scaffolds in NOD/SCID mice: an in vivo model of the leukemia niche. Tissue Eng Part C Methods 2010;16:1523–31.
    OpenUrlCrossRefPubMed
  25. 25.↵
    1. Fenech M
    . Chromosomal biomarkers of genomic instability relevant to cancer. Drug Discov Today 2002;7:1128–37.
    OpenUrlCrossRefPubMed
  26. 26.↵
    1. Shimizu T,
    2. Ishikawa T,
    3. Sugihara E,
    4. Kuninaka S,
    5. Miyamoto T,
    6. Mabuchi Y,
    7. et al.
    c-MYC overexpression with loss of Ink4a/Arf transforms bone marrow stromal cells into osteosarcoma accompanied by loss of adipogenesis. Oncogene 2010;29:5687–99.
    OpenUrlCrossRefPubMed
  27. 27.↵
    1. Kirsch DG,
    2. Dinulescu DM,
    3. Miller JB,
    4. Grimm J,
    5. Santiago PM,
    6. Young NP,
    7. et al.
    A spatially and temporally restricted mouse model of soft tissue sarcoma. Nat Med 2007;13:992–7.
    OpenUrlCrossRefPubMed
  28. 28.↵
    1. Barretina J,
    2. Taylor BS,
    3. Banerji S,
    4. Ramos AH,
    5. Lagos-Quintana M,
    6. Decarolis PL,
    7. et al.
    Subtype-specific genomic alterations define new targets for soft-tissue sarcoma therapy. Nat Genet 2010;42:715–21.
    OpenUrlCrossRefPubMed
  29. 29.↵
    1. Ren YX,
    2. Finckenstein FG,
    3. Abdueva DA,
    4. Shahbazian V,
    5. Chung B,
    6. Weinberg KI,
    7. et al.
    Mouse mesenchymal stem cells expressing PAX-FKHR form alveolar rhabdomyosarcomas by cooperating with secondary mutations. Cancer Res 2008;68:6587–97.
    OpenUrlAbstract/FREE Full Text
  30. 30.↵
    1. Rodriguez R,
    2. Rubio R,
    3. Gutierrez-Aranda I,
    4. Melen GJ,
    5. Elosua C,
    6. Garcia-Castro J,
    7. et al.
    FUS-CHOP fusion protein expression coupled to p53 deficiency induces liposarcoma in mouse but not in human adipose-derived mesenchymal stem/stromal cells. Stem Cells 2011;29:179–92.
    OpenUrlCrossRefPubMed
  31. 31.↵
    1. Ito K,
    2. Carracedo A,
    3. Weiss D,
    4. Arai F,
    5. Ala U,
    6. Avigan DE,
    7. et al.
    A PML-PPAR-delta pathway for fatty acid oxidation regulates hematopoietic stem cell maintenance. Nat Med 2012;18:1350–8.
    OpenUrlCrossRefPubMed
  32. 32.↵
    1. Lunardi A,
    2. Guarnerio J,
    3. Wang G,
    4. Maeda T,
    5. Pandolfi PP
    . Role of LRF/Pokemon in lineage fate decisions. Blood 2013;121:2845–53.
    OpenUrlAbstract/FREE Full Text
  33. 33.↵
    1. Maeda T,
    2. Hobbs RM,
    3. Merghoub T,
    4. Guernah I,
    5. Zelent A,
    6. Cordon-Cardo C,
    7. et al.
    Role of the proto-oncogene Pokemon in cellular transformation and ARF repression. Nature 2005;433:278–85.
    OpenUrlCrossRefPubMed
  34. 34.↵
    1. Maeda T,
    2. Merghoub T,
    3. Hobbs RM,
    4. Dong L,
    5. Maeda M,
    6. Zakrzewski J,
    7. et al.
    Regulation of B versus T lymphoid lineage fate decision by the proto-oncogene LRF. Science 2007;316:860–6.
    OpenUrlAbstract/FREE Full Text
  35. 35.↵
    1. Pardal R,
    2. Clarke MF,
    3. Morrison SJ
    . Applying the principles of stem-cell biology to cancer. Nat Rev Cancer 2003;3:895–902.
    OpenUrlCrossRefPubMed
  36. 36.↵
    1. Espina AG,
    2. Mendez-Vidal C,
    3. Moreno-Mateos MA,
    4. Saez C,
    5. Romero-Franco A,
    6. Japon MA,
    7. et al.
    Induction of Dlk1 by PTTG1 inhibits adipocyte differentiation and correlates with malignant transformation. Mol Biol Cell 2009;20:3353–62.
    OpenUrlAbstract/FREE Full Text
  37. 37.↵
    1. Jiang SS,
    2. Fang WT,
    3. Hou YH,
    4. Huang SF,
    5. Yen BL,
    6. Chang JL,
    7. et al.
    Upregulation of SOX9 in lung adenocarcinoma and its involvement in the regulation of cell growth and tumorigenicity. Clin Cancer Res 2010;16:4363–73.
    OpenUrlAbstract/FREE Full Text
  38. 38.↵
    1. Yanai H,
    2. Nakamura K,
    3. Hijioka S,
    4. Kamei A,
    5. Ikari T,
    6. Ishikawa Y,
    7. et al.
    Dlk-1, a cell surface antigen on foetal hepatic stem/progenitor cells, is expressed in hepatocellular, colon, pancreas and breast carcinomas at a high frequency. J Biochem 2010;148:85–92.
    OpenUrlAbstract/FREE Full Text
  39. 39.↵
    1. Matheu A,
    2. Collado M,
    3. Wise C,
    4. Manterola L,
    5. Cekaite L,
    6. Tye AJ,
    7. et al.
    Oncogenicity of the developmental transcription factor Sox9. Cancer Res 2012;72:1301–15.
    OpenUrlAbstract/FREE Full Text
  40. 40.↵
    1. Wang GL
    , A. Lrf suppresses prostate cancer through repression of a Sox9-dependent pathway for cellular senescence bypass and tumor invasion. Nat Genet 2013;45:739–46.
    OpenUrlCrossRefPubMed
  41. 41.↵
    1. Wang Y,
    2. Sul HS
    . Pref-1 regulates mesenchymal cell commitment and differentiation through Sox9. Cell Metab 2009;9:287–302.
    OpenUrlCrossRefPubMed
  42. 42.↵
    1. Wang G,
    2. Lunardi A,
    3. Zhang J,
    4. Chen Z,
    5. Ala U,
    6. Webster KA,
    7. et al.
    Zbtb7a suppresses prostate cancer through repression of a Sox9-dependent pathway for cellular senescence bypass and tumor invasion. Nat Genet 2013;45:739–46.
    OpenUrlCrossRefPubMed
  43. 43.↵
    1. Liu CJ,
    2. Zhang Y,
    3. Xu K,
    4. Parsons D,
    5. Alfonso D,
    6. Di Cesare PE
    . Transcriptional activation of cartilage oligomeric matrix protein by Sox9, Sox5, and Sox6 transcription factors and CBP/p300 coactivators. Front Biosci 2007;12:3899–910.
    OpenUrlCrossRefPubMed
  44. 44.↵
    1. Xie WF,
    2. Zhang X,
    3. Sakano S,
    4. Lefebvre V,
    5. Sandell LJ
    . Trans-activation of the mouse cartilage-derived retinoic acid-sensitive protein gene by Sox9. J Bone Miner Res 1999;14:757–63.
    OpenUrlCrossRefPubMed
  45. 45.↵
    1. Lefebvre V,
    2. Huang W,
    3. Harley VR,
    4. Goodfellow PN,
    5. de Crombrugghe B
    . SOX9 is a potent activator of the chondrocyte-specific enhancer of the pro alpha1(II) collagen gene. Mol Cell Biol 1997;17:2336–46.
    OpenUrlAbstract/FREE Full Text
  46. 46.↵
    1. Smas CM,
    2. Sul HS
    . Pref-1, a protein containing EGF-like repeats, inhibits adipocyte differentiation. Cell 1993;73:725–34.
    OpenUrlCrossRefPubMed
  47. 47.↵
    1. Smas CM,
    2. Chen L,
    3. Zhao L,
    4. Latasa MJ,
    5. Sul HS
    . Transcriptional repression of pref-1 by glucocorticoids promotes 3T3-L1 adipocyte differentiation. J Biol Chem 1999;274:12632–41.
    OpenUrlAbstract/FREE Full Text
  48. 48.↵
    1. Kim KA,
    2. Kim JH,
    3. Wang Y,
    4. Sul HS
    . Pref-1 (preadipocyte factor 1) activates the MEK/extracellular signal-regulated kinase pathway to inhibit adipocyte differentiation. Mol Cell Biol 2007;27:2294–308.
    OpenUrlAbstract/FREE Full Text
  49. 49.↵
    1. Nueda ML,
    2. Garcia-Ramirez JJ,
    3. Laborda J,
    4. Baladron V
    . dlk1 specifically interacts with insulin-like growth factor binding protein 1 to modulate adipogenesis of 3T3-L1 cells. J Mol Biol 2008;379:428–42.
    OpenUrlCrossRefPubMed
  50. 50.↵
    1. Abdallah BM,
    2. Jensen CH,
    3. Gutierrez G,
    4. Leslie RG,
    5. Jensen TG,
    6. Kassem M
    . Regulation of human skeletal stem cells differentiation by Dlk1/Pref-1. J Bone Miner Res 2004;19:841–52.
    OpenUrlCrossRefPubMed
  51. 51.↵
    1. Wang Y,
    2. Sul HS
    . Ectodomain shedding of preadipocyte factor 1 (Pref-1) by tumor necrosis factor alpha converting enzyme (TACE) and inhibition of adipocyte differentiation. Mol Cell Biol 2006;26:5421–35.
    OpenUrlAbstract/FREE Full Text
  52. 52.↵
    1. Zhu NL,
    2. Asahina K,
    3. Wang J,
    4. Ueno A,
    5. Lazaro R,
    6. Miyaoka Y,
    7. et al.
    Hepatic stellate cell-derived delta-like homolog 1 (DLK1) protein in liver regeneration. J Biol Chem 2012;287:10355–67.
    OpenUrlAbstract/FREE Full Text
  53. 53.↵
    1. Donehower LA,
    2. Harvey M,
    3. Slagle BL,
    4. McArthur MJ,
    5. Montgomery CA Jr,
    6. Butel JS,
    7. et al.
    Mice deficient for p53 are developmentally normal but susceptible to spontaneous tumours. Nature 1992;356:215–21.
    OpenUrlCrossRefPubMed
  54. 54.↵
    1. Maeda T,
    2. Ito K,
    3. Merghoub T,
    4. Poliseno L,
    5. Hobbs RM,
    6. Wang G,
    7. et al.
    LRF is an essential downstream target of GATA1 in erythroid development and regulates BIM-dependent apoptosis. Dev Cell 2009;17:527–40.
    OpenUrlCrossRefPubMed
View Abstract
PreviousNext
Back to top
Cancer Discovery: 5 (4)
April 2015
Volume 5, Issue 4
  • Table of Contents
  • Table of Contents (PDF)
  • About the Cover

Sign up for alerts

View this article with LENS

Open full page PDF
Article Alerts
Sign In to Email Alerts with your Email Address
Email Article

Thank you for sharing this Cancer Discovery article.

NOTE: We request your email address only to inform the recipient that it was you who recommended this article, and that it is not junk mail. We do not retain these email addresses.

Enter multiple addresses on separate lines or separate them with commas.
A Genetic Platform to Model Sarcomagenesis from Primary Adult Mesenchymal Stem Cells
(Your Name) has forwarded a page to you from Cancer Discovery
(Your Name) thought you would be interested in this article in Cancer Discovery.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.
Citation Tools
A Genetic Platform to Model Sarcomagenesis from Primary Adult Mesenchymal Stem Cells
Jlenia Guarnerio, Luisa Riccardi, Riccardo Taulli, Takahiro Maeda, Guocan Wang, Robin M. Hobbs, Min Sup Song, Paolo Sportoletti, Rosa Bernardi, Roderick T. Bronson, Mireia Castillo-Martin, Carlos Cordon-Cardo, Andrea Lunardi and Pier Paolo Pandolfi
Cancer Discov April 1 2015 (5) (4) 396-409; DOI: 10.1158/2159-8290.CD-14-1022

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Share
A Genetic Platform to Model Sarcomagenesis from Primary Adult Mesenchymal Stem Cells
Jlenia Guarnerio, Luisa Riccardi, Riccardo Taulli, Takahiro Maeda, Guocan Wang, Robin M. Hobbs, Min Sup Song, Paolo Sportoletti, Rosa Bernardi, Roderick T. Bronson, Mireia Castillo-Martin, Carlos Cordon-Cardo, Andrea Lunardi and Pier Paolo Pandolfi
Cancer Discov April 1 2015 (5) (4) 396-409; DOI: 10.1158/2159-8290.CD-14-1022
del.icio.us logo Digg logo Reddit logo Twitter logo CiteULike logo Facebook logo Google logo Mendeley logo
  • Tweet Widget
  • Facebook Like
  • Google Plus One

Jump to section

  • Article
    • Abstract
    • Introduction
    • Results
    • Discussion
    • Methods
    • Disclosure of Potential Conflicts of Interest
    • Authors' Contributions
    • Grant Support
    • Acknowledgments
    • Footnotes
    • References
  • Figures & Data
  • Info & Metrics
  • PDF
Advertisement

Related Articles

Cited By...

More in this TOC Section

  • Genetically Defined High-Grade Serous Ovarian Cancer Models
  • Personalized Antibodies for Gastroesophageal Adenocarcinoma
  • Fibroblastic NetG1 Promotes Pancreatic Cancer
Show more Research Articles
  • Home
  • Alerts
  • Feedback
  • Privacy Policy
Facebook   Twitter   LinkedIn   YouTube   RSS

Articles

  • OnlineFirst
  • Current Issue
  • Past Issues

Info For

  • Authors
  • Subscribers
  • Advertisers
  • Librarians

About Cancer Discovery

  • About the Journal
  • Editors
  • Journal Sections
  • Permissions
  • Submit a Manuscript
AACR logo

Copyright © 2021 by the American Association for Cancer Research.

Cancer Discovery
eISSN: 2159-8290
ISSN: 2159-8274

Advertisement