Skip to main content
  • AACR Publications
    • Blood Cancer Discovery
    • Cancer Discovery
    • Cancer Epidemiology, Biomarkers & Prevention
    • Cancer Immunology Research
    • Cancer Prevention Research
    • Cancer Research
    • Clinical Cancer Research
    • Molecular Cancer Research
    • Molecular Cancer Therapeutics

AACR logo

  • Register
  • Log in
  • My Cart
Advertisement

Main menu

  • Home
  • About
    • The Journal
    • AACR Journals
    • Journal Sections
    • Subscriptions
    • Permissions and Reprints
  • Articles
    • OnlineFirst
    • Current Issue
    • Past Issues
    • Collections
      • COVID-19 & Cancer Resource Center
      • Precision Medicine and Therapeutic Resistance
      • Clinical Trials
      • Immuno-oncology
      • Editors' Picks
      • "Best of" Collection
  • For Authors
    • Information for Authors
    • Author Services
    • Best of: Author Profiles
    • Submit
  • Alerts
    • Table of Contents
    • Editors' Picks
    • OnlineFirst
    • Citation
    • Author/Keyword
    • RSS Feeds
    • My Alert Summary & Preferences
  • News
    • Cancer Discovery News
    • Journal Press Releases
  • COVID-19
  • Webinars
  • 10th Anniversary
  • Search More

    Advanced Search

  • AACR Publications
    • Blood Cancer Discovery
    • Cancer Discovery
    • Cancer Epidemiology, Biomarkers & Prevention
    • Cancer Immunology Research
    • Cancer Prevention Research
    • Cancer Research
    • Clinical Cancer Research
    • Molecular Cancer Research
    • Molecular Cancer Therapeutics

User menu

  • Register
  • Log in
  • My Cart

Search

  • Advanced search
Cancer Discovery
Cancer Discovery
  • Home
  • About
    • The Journal
    • AACR Journals
    • Journal Sections
    • Subscriptions
    • Permissions and Reprints
  • Articles
    • OnlineFirst
    • Current Issue
    • Past Issues
    • Collections
      • COVID-19 & Cancer Resource Center
      • Precision Medicine and Therapeutic Resistance
      • Clinical Trials
      • Immuno-oncology
      • Editors' Picks
      • "Best of" Collection
  • For Authors
    • Information for Authors
    • Author Services
    • Best of: Author Profiles
    • Submit
  • Alerts
    • Table of Contents
    • Editors' Picks
    • OnlineFirst
    • Citation
    • Author/Keyword
    • RSS Feeds
    • My Alert Summary & Preferences
  • News
    • Cancer Discovery News
    • Journal Press Releases
  • COVID-19
  • Webinars
  • 10th Anniversary
  • Search More

    Advanced Search

Research Briefs

A Recurrent ERCC3 Truncating Mutation Confers Moderate Risk for Breast Cancer

Joseph Vijai, Sabine Topka, Danylo Villano, Vignesh Ravichandran, Kara N. Maxwell, Ann Maria, Tinu Thomas, Pragna Gaddam, Anne Lincoln, Sarah Kazzaz, Brandon Wenz, Shai Carmi, Kasmintan A. Schrader, Steven N. Hart, Steve M. Lipkin, Susan L. Neuhausen, Michael F. Walsh, Liying Zhang, Flavio Lejbkowicz, Hedy Rennert, Zsofia K. Stadler, Mark Robson, Jeffrey N. Weitzel, Susan Domchek, Mark J. Daly, Fergus J. Couch, Katherine L. Nathanson, Larry Norton, Gad Rennert and Kenneth Offit
Joseph Vijai
1Department of Medicine, Memorial Sloan Kettering Cancer Center, New York, New York.
2Cancer Biology and Genetics Program, Memorial Sloan Kettering Cancer Center, New York, New York.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Sabine Topka
1Department of Medicine, Memorial Sloan Kettering Cancer Center, New York, New York.
2Cancer Biology and Genetics Program, Memorial Sloan Kettering Cancer Center, New York, New York.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Danylo Villano
1Department of Medicine, Memorial Sloan Kettering Cancer Center, New York, New York.
2Cancer Biology and Genetics Program, Memorial Sloan Kettering Cancer Center, New York, New York.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Vignesh Ravichandran
1Department of Medicine, Memorial Sloan Kettering Cancer Center, New York, New York.
2Cancer Biology and Genetics Program, Memorial Sloan Kettering Cancer Center, New York, New York.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Kara N. Maxwell
3Division of Hematology/Oncology, Department of Medicine, Perelman School of Medicine at the University of Pennsylvania, Philadelphia, Pennsylvania.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Ann Maria
1Department of Medicine, Memorial Sloan Kettering Cancer Center, New York, New York.
2Cancer Biology and Genetics Program, Memorial Sloan Kettering Cancer Center, New York, New York.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Tinu Thomas
1Department of Medicine, Memorial Sloan Kettering Cancer Center, New York, New York.
2Cancer Biology and Genetics Program, Memorial Sloan Kettering Cancer Center, New York, New York.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Pragna Gaddam
1Department of Medicine, Memorial Sloan Kettering Cancer Center, New York, New York.
4Clinical Genetics Service, Department of Medicine, Memorial Sloan Kettering, New York, New York.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Anne Lincoln
1Department of Medicine, Memorial Sloan Kettering Cancer Center, New York, New York.
4Clinical Genetics Service, Department of Medicine, Memorial Sloan Kettering, New York, New York.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Sarah Kazzaz
1Department of Medicine, Memorial Sloan Kettering Cancer Center, New York, New York.
2Cancer Biology and Genetics Program, Memorial Sloan Kettering Cancer Center, New York, New York.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Brandon Wenz
3Division of Hematology/Oncology, Department of Medicine, Perelman School of Medicine at the University of Pennsylvania, Philadelphia, Pennsylvania.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Shai Carmi
5Braun School of Public Health and Community Medicine, The Hebrew University of Jerusalem, Jerusalem, Israel.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Kasmintan A. Schrader
6British Columbia Cancer Agency, Canada's Michael Smith Genome Sciences Centre, Vancouver, Canada.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Steven N. Hart
7Department of Health Sciences Research, Mayo Clinic, Rochester, Minnesota.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Steve M. Lipkin
8Department of Medicine, Weill Cornell Medical College, New York, New York.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Susan L. Neuhausen
9Department of Population Sciences, Beckman Research Institute of City of Hope, Duarte, California.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Michael F. Walsh
1Department of Medicine, Memorial Sloan Kettering Cancer Center, New York, New York.
4Clinical Genetics Service, Department of Medicine, Memorial Sloan Kettering, New York, New York.
10Department of Pediatrics, Memorial Sloan Kettering Cancer Center, New York, New York.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Liying Zhang
11Department of Pathology, Memorial Sloan Kettering Cancer Center, New York, New York.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Flavio Lejbkowicz
12Clalit National Israeli Cancer Control Center and Department of Community Medicine and Epidemiology, Carmel Medical Center and B Rappaport Faculty of Medicine, Haifa, Israel.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Hedy Rennert
12Clalit National Israeli Cancer Control Center and Department of Community Medicine and Epidemiology, Carmel Medical Center and B Rappaport Faculty of Medicine, Haifa, Israel.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Zsofia K. Stadler
1Department of Medicine, Memorial Sloan Kettering Cancer Center, New York, New York.
4Clinical Genetics Service, Department of Medicine, Memorial Sloan Kettering, New York, New York.
8Department of Medicine, Weill Cornell Medical College, New York, New York.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Mark Robson
1Department of Medicine, Memorial Sloan Kettering Cancer Center, New York, New York.
4Clinical Genetics Service, Department of Medicine, Memorial Sloan Kettering, New York, New York.
8Department of Medicine, Weill Cornell Medical College, New York, New York.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Jeffrey N. Weitzel
13Clinical Cancer Genetics (for the City of Hope Clinical Cancer Genetics Community Research Network), City of Hope, Duarte, California.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Susan Domchek
3Division of Hematology/Oncology, Department of Medicine, Perelman School of Medicine at the University of Pennsylvania, Philadelphia, Pennsylvania.
14Division of Translational Medicine and Human Genetics, Department of Medicine, Perelman School of Medicine at the University of Pennsylvania, Philadelphia, Pennsylvania.
15Abramson Cancer Center, Perelman School of Medicine at the University of Pennsylvania, Philadelphia, Pennsylvania.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Mark J. Daly
16Broad Institute of Harvard and Massachusetts Institute of Technology, Cambridge, Massachusetts.
17Center for Human Genetic Research and Department of Medicine, Massachusetts General Hospital, Boston, Massachusetts.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Fergus J. Couch
7Department of Health Sciences Research, Mayo Clinic, Rochester, Minnesota.
18Department of Laboratory Medicine and Pathology, and Health Sciences Research, Mayo Clinic, Rochester, Minnesota.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Katherine L. Nathanson
3Division of Hematology/Oncology, Department of Medicine, Perelman School of Medicine at the University of Pennsylvania, Philadelphia, Pennsylvania.
14Division of Translational Medicine and Human Genetics, Department of Medicine, Perelman School of Medicine at the University of Pennsylvania, Philadelphia, Pennsylvania.
15Abramson Cancer Center, Perelman School of Medicine at the University of Pennsylvania, Philadelphia, Pennsylvania.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Larry Norton
1Department of Medicine, Memorial Sloan Kettering Cancer Center, New York, New York.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Gad Rennert
12Clalit National Israeli Cancer Control Center and Department of Community Medicine and Epidemiology, Carmel Medical Center and B Rappaport Faculty of Medicine, Haifa, Israel.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Kenneth Offit
1Department of Medicine, Memorial Sloan Kettering Cancer Center, New York, New York.
2Cancer Biology and Genetics Program, Memorial Sloan Kettering Cancer Center, New York, New York.
4Clinical Genetics Service, Department of Medicine, Memorial Sloan Kettering, New York, New York.
8Department of Medicine, Weill Cornell Medical College, New York, New York.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • For correspondence: offitk@mskcc.org
DOI: 10.1158/2159-8290.CD-16-0487 Published November 2016
  • Article
  • Figures & Data
  • Info & Metrics
  • PDF
Loading

Abstract

Known gene mutations account for approximately 50% of the hereditary risk for breast cancer. Moderate and low penetrance variants, discovered by genomic approaches, account for an as-yet-unknown proportion of the remaining heritability. A truncating mutation c.325C>T:p.Arg109* (R109X) in the ATP-dependent helicase ERCC3 was observed recurrently among exomes sequenced in BRCA wild-type, breast cancer–affected individuals of Ashkenazi Jewish ancestry. Modeling of the mutation in ERCC3-deficient or CRISPR/Cas9-edited cell lines showed a consistent pattern of reduced expression of the protein and concomitant hypomorphic functionality when challenged with UVC exposure or treatment with the DNA alkylating agent IlludinS. Overexpressing the mutant protein in ERCC3-deficient cells only partially rescued their DNA repair–deficient phenotype. Comparison of frequency of this recurrent mutation in over 6,500 chromosomes of breast cancer cases and 6,800 Ashkenazi controls showed significant association with breast cancer risk (ORBC = 1.53, ORER+ = 1.73), particularly for the estrogen receptor–positive subset (P < 0.007).

Significance: A functionally significant recurrent ERCC3 mutation increased the risk for breast cancer in a genetic isolate. Mutated cell lines showed lower survival after in vitro exposure to DNA-damaging agents. Thus, similar to tumors arising in the background of homologous repair defects, mutations in nucleotide excision repair genes such as ERCC3 could constitute potential therapeutic targets in a subset of hereditary breast cancers. Cancer Discov; 6(11); 1267–75. ©2016 AACR.

This article is highlighted in the In This Issue feature, p. 1197

Introduction

Genetic susceptibility to breast cancer has been shown to be strongly associated with rare coding gene mutations and common noncoding genomic variants (1). Loss-of-function mutations in well-characterized genes, such as those in BRCA1/2 and other members of the homologous recombination pathway, are routinely used for clinical risk assessment in cancer, but account for a small fraction of excess familial risk (2). Common single-nucleotide polymorphisms (SNP) are yet to demonstrate clinical utility, but over 90 SNPs account for over 37% of familial relative risk (3). An as-yet-to-be-defined proportion of the remaining familial risk is accounted for by variants of “moderate” risk, including coding or noncoding variants in the DNA repair pathways such as nucleotide excision repair (NER), mismatch repair (MMR), and base excision repair (BER), which play an important role in checkpoint and genomic integrity maintenance (4, 5). In addition to serving as candidate cancer susceptibility genes, members of the NER pathway also play a critical role in DNA-damage repair caused by chemotherapeutic agents and radiation exposure. ERCC3 is an ATP-dependent DNA helicase that is part of the TFIIH transcription factor complex. In this report, we characterize the functions of a recurrent founder mutation in ERCC3 and demonstrate its association with breast cancer risk.

Results

Identification of a Recurrent ERCC3 R109X Mutation in Ashkenazi Probands with BRCA1/2 Wild-Type Breast Cancer

Exome sequencing was carried out on DNA extracted from peripheral blood/saliva of 46 early-onset (<45 years) and 13 familial BRCA wild-type (WT) breast cancer probands (33 with known ER-positive status) of Ashkenazi Jewish ancestry. We filtered for rare protein truncating variants using public data sources such as the Exome Sequencing Project (ESP), 1000 Genomes, and the Exome Aggregation Consortium (ExAC) without The Cancer Genome Atlas. We further filtered for recurrent mutations in the DNA-repair genes with low background mutation load using the smallest residual variation intolerance score percentage (6) amongst 70 genes, calculated based on the ExAC data. We observed three individuals in the same BRCA WT kindred (Fig. 1) with the same protein truncating mutation, R109X in ERCC3 (HGMD: c.325C>T: p.R109*; chr2:128050332; rs34295337). Sanger sequencing was used to confirm the next-generation sequencing findings (shown in Supplementary Fig. S1). Two of the siblings were affected with ER-positive breast cancer, and the third was a male with breast cancer. The same mutation was also observed in two other individuals at relatively young age (<40 years), from unrelated kindreds with multiple cases of breast cancer. Details of the families and cancer incidence are described in Supplementary Table S1. The variant is almost absent in other world populations, and relatively rare in Caucasians in public data sources such as the ExAC Consortium (Non-Finnish EUR MAF = 0.0008; ESP-EUR MAF = 0.0007). Analysis of the structure of the first 300 amino acids of ERCC3 shows that R109 is most likely part of a right-handed alpha helix (Supplementary Fig. S2). However, no crystal structure is available for high confidence prediction.

Figure 1.
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 1.

Identification of germline mutations in ERCC3 in a family with multiple breast cancer cases. Sequencing was performed on three individuals affected with breast cancer, confirming identification of ERCC3 R109X in all three affected siblings. Pathology reports for individuals II-3 and II-5 show both with well-differentiated (low-grade) invasive ductal carcinoma diagnosed at Stage IA. One of the tumors was ER+PR+HER2+ (II-3) and the other one was ER+PR−HER2− (II-5). Double-digit numbers indicate age at diagnosis. For individuals I-4 and I-5, age at diagnosis was not available.

Phenotype Rescue by Complementation Assay

To understand whether this variant has a deleterious effect on the gene function, we carried out a series of invitro functional assays. Using a previously well-characterized ERCC3-deficient cell line derived from a patient with combined xeroderma pigmentosum/Cockayne syndrome (XP/CS; ref. 7), phenotype rescue after DNA damage was assessed by cell viability assay. The parental XPCS2BA cell line and derived lines stably overexpressing the ERCC3 R109* mutant (R109X) or the WT ERCC3 (Fig. 2A and B) showed varying degrees of sensitivity to DNA damage–inducing agents such as UVC and a fungal sesquiterpene IlludinS. We observed that cells overexpressing ERCC3 R109X showed significantly higher cell death compared with the ERCC3 WT, whereas the untransfected cells all died upon exposure to higher doses of both IlludinS and UVC (Fig. 2C and D). Exposure at 2 ng/mL of IlludinS (Fig. 2C), a fungal toxin from the Jack O' Lantern mushroom (Omphalotus illudens) that creates DNA damage, which blocks transcription with demonstrated antitumor activity (8), showed that 3%, 42%, and 77% of the XPCS2BA, R109X, and WT cells survived, respectively (P < 0.0001). At a dose of 4 ng/mL, most of the WT cells survived, demonstrating that the mutant cells were transiently and partially able to withstand UV-induced DNA damage, while failing to adequately repair DNA damage to ensure survival. Similarly, following UVC irradiation at a dose of 10 J/m2, 72 hours after exposure, 42% of the R109X cells survived compared with 63% of WT cells (P < 0.0001). At a dose of 4 ng/mL, these numbers reduced more drastically for the mutant, showing the same trend as the IlludinS exposure experiment (Fig. 2D).

Figure 2.
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 2.

Functional evaluation of the ERCC3 mutant via overexpression in an ERCC3-deficient cell line. A, transcript and B, protein levels in XPCS2BA parental cell line and cell lines stably overexpressing a lentiviral construct containing WT ERCC3 (WT) or the R109X mutant (R109X) cDNA. Expression from the mutant cDNA produces a truncated protein fragment of about 12kDa. C–D, relative cell viability of XPCS2BA and ERCC3 WT and mutant overexpressing cell lines at 72 hours following treatment with increasing doses of IlludinS (C) or UVC (D). E, host cell reactivation assay showing reduced DNA repair ability of the mutant as opposed to WT ERCC3-overexpressing cell lines. Data represent the mean of three experiments with error bars representing the SD (C) or SEM (D and E). F, phosphorylation of H2AX and CHK1 in response to UVC-induced DNA damage. XPCS2BA, WT, or R109X cell lines were harvested at different time points following exposure to 20 J/m2 UVC, and activation of H2AX and CHK1 was assessed by Western blotting.

Host Cell Reactivation Assay

Using an exogenous source of DNA, namely a luciferase reporter plasmid, we measured the ability of intact live cells to repair DNA damage. Through measurement of the reporter, the extent of reactivation of the damaged plasmid is quantitated and is a readout of DNA-repair activity. Relative luminescence measured after cotransfection of the reporter plasmid (exposed to 600 J/m2) showed a 1.5-fold difference between mutant and WT overexpression cell lines, suggesting a markedly reduced reporter reactivation in the R109X (Fig. 2E; P < 0.0001). We observed almost no reactivation in the parental cell line at this dose.

Activation of the DNA-Damage Response Pathway Following UVC Irradiation

DNA-damage response is marked by activation of H2AX (γH2AX) and leads to the induction of cell-cycle checkpoint initiation by activation of CHK1. To explore the ability of ERCC3 R109X to trigger the checkpoint cascade in response to DNA damage, we examined γH2AX and phosphorylated CHK1 following UVC-mediated DNA-damage induction in XPCS2BA cells. UV-induced phosphorylation of H2AX is reduced in cells deficient in the nucleotide excision repair pathway (9). In agreement with this, we found lower levels of activated H2AX in the XPCS2BA cell line compared with cells where WT ERCC3 expression had been restored. In the mutant, we observed lower γH2AX levels, almost as low as in the parental cell line. Activation of the checkpoint kinase CHK1 was also strongly reduced in the mutant as compared with the WT-overexpressing cells, and similar to the untransfected XPCS2BA (Fig. 2F).

Functional Characterization of Genome-Edited ERCC3 Mutants in Human Mammary Epithelial Cells

Overexpression of ERCC3-mutant constructs does not recapitulate physiologic levels of protein in a germline heterozygous mutation state within cells. Therefore, using CRISPR/Cas9, we engineered several heterozygous mutations in the mammary epithelial cell line HMLE that mimic the site of the originally discovered recurrent mutation in individuals with breast cancer (Supplementary Table S2; Supplementary Fig. S3). Quantitative real-time PCR of ERCC3 transcripts (exons 1, 2 and exons 9, 10) showed relative transcript levels reduced by half in these cells when compared with the parental HMLE cell line (Fig. 3A). Western blotting also showed the reduction in total ERCC3 protein levels (Fig. 3B), suggesting that in the CRISPR clones, ERCC3 is transcribed mainly from the remaining WT allele. Because we did not observe any homozygous mutations amongst the surviving CRISPR clones, we are unsure if a homozygous mutation is viable. The ERCC3 CRISPR clones generally showed substantial reduction in relative cell viability 72 hours after exposure to IlludinS (Fig. 3C). At 2 ng/mL IlludinS, all the parental HMLE cells survived, whereas the CRISPR edited cell lines showed significantly reduced survival (P < 0.0001). These data suggest that the mutants function at a much lower efficiency compared with WT and hence may be classified as hypomorphs. To demonstrate that the observed effect of IlludinS on the viability of the CRISPR-edited HMLE is specific to the resulting ERCC3 deficit, we performed rescue experiments by overexpressing WT ERCC3 in these cells. We observed that the ERCC3 CRISPR cell lines, after stable overexpression of WT ERCC3, showed the same response to IlludinS as the WT HMLE cell line (Fig. 3D), thereby showing complete rescue of the phenotype, confirming that this phenotype was indeed a result of the engineered ERCC3 deficiency.

Figure 3.
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 3.

Modeling of ERCC3 R109X by CRISPR/Cas9 in a mammary epithelial cell line and functional analysis. A, ERCC3 transcript and (B) protein levels in HMLE and CRISPR/Cas9-edited cell lines modeling the heterozygous R109X mutation. C, relative cell viability of HMLE control and CRISPR-edited cell lines at 72 hours following treatment with increasing doses of IlludinS. Data represent the mean of three experiments with error bars representing the SEM. D, relative cell viability of HMLE control and combined CRISPR-edited cell lines (with and without reexpression of the WT ERCC3) following treatment with IlludinS. E, quantification of phosphorylated H2AX by flow cytometry in HMLE control and CRISPR-edited cell lines harvested at different time points after DNA damage. Asterisks refer to the P values determined by a 2-way ANOVA comparing the reduction in H2AX fluorescence at the respective time points between the WT HMLE and CRIPSR-edited HMLE cell lines (P ≤ 0.05).

To assess the induction and removal of phosphorylated H2AX in response to DNA damage, we performed immunostaining and flow cytometric analysis of γH2AX-positive cells following treatment with IlludinS. Although this led to a similar fold induction of γH2AX-positive cells in the WT and CRISPR clones (not shown), the reduction in γH2AX was significantly lower in the ERCC3 CRISPR mutants, indicating less efficient DNA-damage repair in these cells (P < 0.05; Fig. 3E).

ERCC3 R109X as a Risk Allele for Breast Cancer in Ashkenazim

Using breast cancer–affected individuals and controls from the Memorial Sloan Kettering Cancer Center (MSKCC), the University of Pennsylvania, and the Clalit National Israeli Cancer Control Center, we performed a matched case–control association of the ERCC3 variant using TaqMan genotyping and sequencing across 3,286 cases and 2,716 controls. A third group of 705 controls was sourced from The Ashkenazi Genome Consortium (TAGC) project (ref. 10 and in preparation) control resource (Table 1A). All control groups showed similar allele frequencies. A total of 101 heterozygote carriers were present in the combined data. A 1.53-fold increased risk was observed for breast cancer (OR = 1.53, lower CI = 1.07; P = 0.023) after examining over 6,500 chromosomes in cases and 6,800 chromosomes in controls (Table 1A). A stronger association was observed with the ER-positive subtype (OR = 1.73, lower CI = 1.19; P = 0.007; Table 1B). The majority of the tumors in the carriers had an ER-positive status. These data show that the ERCC3 c.325 T allele is a moderate risk factor for breast cancer in individuals of Ashkenazi ancestry. Unphased haplotype analyses from the TAGC heterozygote carriers suggested a founder mutation (Supplementary Fig. S4). In the chromosomal region 2q14.3, a 3.4 cM–long haplotype was observed in the carriers which was significantly longer than in noncarriers (P < 10−14).

View this table:
  • View inline
  • View popup
Table 1A.

Association of ERCC3 R109X risk allele to breast cancer

View this table:
  • View inline
  • View popup
Table 1B.

Association of ERCC3 R109X risk allele to ER-positive breast cancer

Discussion

Here, we identified a truncating germline mutation in the first putative helicase domain of the DNA-repair gene ERCC3 and report a strong genetic association with risk of breast cancer in individuals of Ashkenazi Jewish ancestry. The R109X variant, seen in 1.83% of Ashkenazi Jewish individuals with breast cancer and 2.06% in the ER-positive subset, confers moderate risk (ORBC = 1.53; ORER+ = 1.73). The same mutation was also observed twice as a somatic event in a breast carcinoma and a soft-tissue sarcoma (Supplementary Fig. S5A). Mutations within the ERCC3 helicase domain are also often seen in tumors such as melanoma, in addition to non–small cell lung cancer and colorectal, esophagogastric, and bladder cancers. In general, ERCC3 is seldom disrupted in somatic tissue by genomic integrity loss such as amplification or deletions (Supplementary Fig. S5B). In the LOVD database, the variant was seen in 6 of 8,600 individuals of European ancestry, a similar frequency to public databases. As a core component of the TFIIH basal transcription factor, ERCC3 ATP-dependent DNA helicase has key functions in both RNA transcription by RNA polymerase II and in NER following DNA damage (11). It has previously been associated with Mendelian DNA repair disorders such as XP, XP/CS, and trichothiodystrophy (TTD) with hallmarks of increased photosensitivity, cancer predisposition, and impaired development (12, 13). Hypomorphic mutations in the DNA-damage repair gene NBN cause the autosomal recessive chromosomal instability disorder Nijmegen breakage syndrome (NBS) in homozygous individuals, but have also been shown to lead to increased cancer incidence in heterozygous relatives of patients with NBS, thus providing a plausible example of a hypomorphic mutation that is also a susceptibility gene (14, 15). Similarly, ERCC3 R109X behaves as a hypomorph in our functional assays. In experiments using an ERCC3-deficient cell line, R109X was partially successful at phenotype rescue, with the cells exhibiting intermediate repair capability, suggesting that they are more likely to harbor a second hit following genotoxic events. Importantly, ERCC3 transcript expression was shown to be lower in the proband's cells compared with a non–mutation carrier (Supplementary Fig. S6). Dosage dependency of key molecular components of the DNA-damage repair pathway, such as haploinsufficiency, has been previously demonstrated (16–20), leading to tumorigenesis in in vitro and in vivo models of H2AX, BLM, and CHEK1.

ERCC3 homozygous knockout mice have been shown to be embryonic lethal, indicating that the gene is necessary for development (21). Additionally, very few ERCC3 mutations have been reported, even amongst patients with XP, suggesting the gene is intolerant to common mutational mechanisms. Analysis of gene-based mutability from the ESP and ExAC exome data has shown that quantitative metrics that predict gene conservation and mutation tolerance rank ERCC3 as bearing low background mutational load (22). In light of the rarity of known mutations in ERCC3, there have thus far been no studies elucidating cancer susceptibility in heterozygous carriers. The only mouse model that has been described modeled the XP/CS hereditary DNA repair deficiency syndromes (21). Animals with heterozygous knockout of the NER genes XPC and XPE/DDB2 showed increased cancer incidence after exposure to UV irradiation (23, 24), whereas heterozygous XPC knockout mice also showed elevated frequency of spontaneous mutations as a function of age (25). Also, a mouse model harboring a mutation in the other helicase of the TFIIH complex, XPD, showed a strongly increased cancer incidence in response to UV exposure (26).

This is the first study that shows a specific truncating mutation in ERCC3 conferring increased risk of breast cancer. However, polygenes in DNA repair and/or other pathways, acting epistatically with ERCC3, are likely contributors to and modifiers of the heritable risk of breast cancer, complicating attempts to demonstrate cosegregation of single variants in multiplex kindreds. We have previously demonstrated a modestly elevated breast cancer risk associated with specific mutations of CHEK2 and APC in the Ashkenazi Jewish genetic isolate (27, 28), and other recurring mutations of CHEK2, HOXB13, PALB2, and RAD51C have been variably associated with breast cancer risk in diverse populations (29–32). Although ERCC3 R109X is more frequent in Ashkenazi Jews, we have observed it as well as other ERCC3 mutations in non-Ashkenazi individuals (data not shown), but because of the rarity of these ERCC3 mutations, further population-based studies will be required to assess their role as breast cancer susceptibility alleles. Although the relative risks of 1.5 to 2.0 shown here are higher than those associated with most genome-wide association study SNPs, the clinical utility of variants associated with risks in this range remains to be established. Nonetheless, these discoveries provide insight into molecular pathways of breast cancer pathogenesis and potentially identify therapeutic targets (33–36). The enhanced susceptibility of ERCC3-mutant cells to reagents of the fungal sesquiterpene class, demonstrated here, suggests additional in vivo studies of the therapeutic efficacy versus toxicity of these compounds against breast tumors in an ERCC3-mutant genetic background.

Methods

Next-Generation Sequencing of Breast Cancer Probands and Controls

One microgram of germline DNA extracted from peripheral blood was used for whole-exome capture using the Agilent SureSelect 38-Mb paired-end sequencing with the Illumina HiSeq 2000. Sequence reads in the form of FASTQ files were aligned to the human decoy reference (GRCh37) to generate BAM files using Burrows-Wheeler Aligner (BWA) v0.7.12. Picard tools were used for quality metric calculation and marking duplicate reads. The Genome Analysis Tool Kit (GATK) version 3.3.0-g37228af was used for variant calling using the haplotype caller algorithm. Variant quality score recalibrated (VQSR) data were used for filtering variants. Variant-level and interval-level annotations were performed using SNPEff, ANNOVAR, and CAVA programs. Downstream analysis consisted of filtering out low-quality variant calls and those already reported as common in public databases.

The TAGC has sequenced the whole genomes of 128 and 577 individuals of Ashkenazi Jewish ancestry using the Complete Genomics and Illumina X10 sequencing platform at the New York Genome Center, respectively. The paired-end libraries were generated using the TruSeq DNA Nano Kit, sequenced to an average depth of 30, and reads were aligned using a standard pipeline involving BWA version 0.7.8 and GATK version 3.2.2. Extensive quality control is performed on all whole-genome sequencing samples, including alignment rates (>97%), median and mean library insert size (>350bp), percent duplication (typically <20%), mean genome coverage (>30×) and uniformity of coverage, TiTv and Het-Hom ratios. An automated concordance check is also performed against the SNP array genotyping data, to ensure against sample swap at any step during the sequencing process, and to further validate the quality of the single-nucleotide variant calls from the sequencing data.

All research participants provided written consent to an Institutional Review Board–approved research protocol to allow for the collection and use of biospecimens.

Haplotype Analysis

Using only high-quality biallelic SNPs, the haplotype lengths carrying the ERCC3 R109X mutation were calculated to either side of the mutation in the TAGC carriers as the length until an opposite homozygous genotype. This is an overestimate, due to the lack of accurate phasing information. The mean length was 3.4 cM, estimated by using the HapMap recombination rates for the region. The mean lengths of haplotypes shared between noncarriers were also computed. The significance of the difference between the distributions of haplotype lengths at the carriers and at 100 random noncarriers was calculated using the Kolmogorov–Smirnov test.

Sanger Sequencing

Sanger sequencing of the ERCC3 R109X variant was performed using the following primers:

  • ERCC3_F1: CATGGAGCACCTATGCCTATT

  • ERCC3_R1: CTGCAACTCATGTTTCCTTGTC

TaqMan Genotyping

The allelic discrimination assay C__25963434_10 for genotyping was done using TaqMan (Life Technologies). The assay was run on an ABI HT7900 machine and automatically clustered and manually reviewed. Confirmed heterozygotes were run as positive controls, and duplicate concordances were checked per plate.

Statistical Analyses

Allele counts were tabulated from the TaqMan genotyping after QC. Statistical analysis was performed using the R statistical package using the fisher.test module. Because the truncating genetic variant was hypothesized and shown by functional assays to lead to increased risk associated with reduced DNA repair efficiency, we report one-sided Fisher exact test results. Nevertheless, two-sided tests for both breast cancer and ER status were also significant at the 5% level (breast cancer overall: P = 0.036, OR = 1.53, 95% CI = 1.01–2.34; ER+: P = 0.011, OR = 1.73, 95% CI = 1.11–2.70).

Plasmids

The pENTR221 plasmid containing human ERCC3 ORF was purchased from TransOMIC. The ERCC3 ORF was cloned into the pLX302 lentiviral expression plasmid, a gift from David Root, Broad Institute of MIT and Harvard (Addgene # 25896). The ERCC3 R109X mutant was generated from the WT ERCC3 plasmid using the QuickChange II XL Site-Directed Mutagenesis Kit (Agilent). pSpCas9(BB)-2A-GFP (PX458) was a gift from Feng Zhang, Broad Institute of MIT and Harvard (Addgene # 48138). Guide RNAs were designed using the CRISPR Design Tool (37). The 24-mer oligonucleotides were synthesized (ref. 37; Integrated DNA Technologies), annealed, and cloned into pX458.

Cell Culture and Transfections

The HMLE cell line, established in the laboratory of Robert A. Weinberg at the Whitehead Institute for Biomedical Research, Cambridge, MA, was grown in mammary epithelial growth medium (MEGM) and supplements as recommended by Lonza. The XPCSBA-sv40 cell line was grown in RPMI-1640–HEPES medium (Invitrogen), supplemented with 10% FBS and 1% penicillin–streptomycin and glutamate. HEK293T cells (ATCC; CRL-3216) were maintained in DMEM supplemented with 10% FBS and 1% penicillin–streptomycin and glutamate. The HMLE and HEK293T lines were kindly provided by Robert Benezra (MSKCC), and the XPCSBA-sv40 cell line was a generous gift from Jan Hoeijmakers (Erasmus MC, Rotterdam, the Netherlands). The cell lines were not further authenticated. Cell cultures were maintained in a humidified incubator at 37°C in 5% CO2 and tested for Mycoplasma on a monthly basis.

Transfections were carried out with the Amaxa Cell Line Nucleofector Kit V (Lonza) and Nucleofector IIb device according to the manufacturer's instructions. Viral vectors, cotransfected with psPAX2 and pseudotyped with VSV-G, were produced in HEK293T cells using the Lipofectamin2000 transfection reagent. The virus supernatant was concentrated by centrifugation for 90 minutes at 20,000 RPM at 4°C, and pellets were dissolved in OptiMEM (Gibco). Transduction of cells with virus supernatant was carried out in the presence of 8 μg/mL polybrene. Stably transfected cell lines were generated by selection with 0.5 μg/mL puromycin.

Cells cotransfected with pmaxGFP (Lonza) and the pX458-sgRNA plasmids, containing guide RNAs targeting the ERCC3 locus in close proximity to the ERCC3 mutation site (chr2: 128050332) with or without a repair template (ssODN) containing the specific mutation, were sorted as single cells into 96-well plates based on GFP fluorescence using a BD FACSAria cell sorter.

Screening of CRISPR/Cas9-Edited Cell Lines

Single-cell clones generated from the transfection mentioned above were expanded and genomic DNA extracted using the QuickExtract DNA Extraction Solution (Epicentre). The genomic region surrounding the target site was amplified using the following primer sequences:

  • ERCC3_SURV F, 5′-TGTGGTGTTGGGCAGCTTAT-3′;

  • ERCC3_SURV R, 5′-ACACTCACTTTGGGCTGCAT-3′

  • The purified PCR products were subjected to Sanger sequencing.

Real-Time PCR

RNA was extracted 24 hours after transduction using the RNeasy Mini Kit (Qiagen) and reverse transcribed with the ReadyScript cDNA Synthesis Mix (Sigma-Aldrich). Quantitative real-time PCR analyses were performed on an ABI PRISM 7900HT Sequence Detection System using the Power SYBR Green PCR Master Mix (Life Technologies) according to the manufacturer's instructions. Following initial incubation for 10 minutes at 95°C, amplification was performed for 40 cycles at 95°C for 15 seconds and 60°C for 1 minute. The RPL32 gene was used as the internal standard. Analysis was performed based on the comparative CT method. Values reported are mean of triplicate experiments. The following primer sequences were used:

  • RPL32 F, 5′-CATCTCCTTCTCGGCATCA-3′;

  • RPL32 R, 5′-AACCCTGTTGTCAATGCCTC-3′;

  • ERCC3 F1, 5′-GTCCGCGAAGATGACAAAATTG-3′;

  • ERCC3 R1, 5′-AATTCAGGAGACATAGGGCAC-3′;

  • ERCC3 F3, 5′-ATGGGCAAAAGAGACCGAG-3′;

  • ERCC3 R3, 5′-CTGACTCATCCACCTGCTTC-3′

Western Blotting

Protein lysates were prepared in RIPA buffer (Pierce). Samples were run on 4% to 12% gradient Bis-Tris SDS-PAGE gels (Invitrogen), transferred onto PVDF membranes (Bio-Rad), and probed with antibodies against ERCC3 (ARP37963_P050; 1:2,500; Aviva Systems Biology), phospho-Histone H2A.X (Ser139; 1:1,000; Cell Signaling Technology), phospho-CHK1 (Ser345; 1:1,000; Cell Signaling Technology), and GAPDH (V-18; 1:400; Santa Cruz Biotechnology). HRP-conjugated secondary antibodies were detected using ECL Prime Western Blotting Detection Reagent (GE Healthcare).

Cell Viability Assays

For viability assessment following treatment with IlludinS (Cayman Chemical), cells were seeded into 96-well plates 24 hours prior to treatment. For post-UV viability assays, cells were exposed to the appropriate doses of UV irradiation and subsequently seeded into 96-well plates. Cell viability was measured after 72 hours using the CellTiter-Glo Luminescent Cell Viability Assay (Promega).

Host Cell Reactivation Assay

The pIS0 plasmid, derived from the pGL3-control vector containing the Firefly luciferase gene (Promega) and the pIS2, a derivative from the pRL-SV40 vector (Promega) containing the Renilla luciferase gene (as an internal transfection control), were used for transfection of cells. The pIS0 vector was treated with increasing doses of UVC radiation. These vectors were cotransfected into the XPCS2BA and stable ERCC3 WT and R109X-overexpressing cell lines using the Fugene 6 Transfection Reagent (Promega). Forty-eight hours after DNA transfection, the luciferases' activity was measured with the Dual-Glo Luciferase Assay System (Promega) and a GloMAX Luminometer (Promega).

Flow Cytometry

For flow cytometric analysis, 24 hours after seeding, cells were either left untreated or were treated with 8 ng/mL IlludinS for 1 hour. Treated cells were subsequently washed with PBS and supplemented with drug-free medium. The cells were harvested at different time points after treatment and fixed with 4% paraformaldehyde for 10 minutes at room temperature. Cells were quickly chilled on ice, and ice-cold MeOH was added to a final concentration of 90%. The cells were incubated on ice for 30 minutes and stored at −20°C. For immunostaining, the cells were washed twice with PBS/0.5% BSA and incubated with anti–phospho-Histone H2A.X (Ser139) antibody (1:250; Cell Signaling Technology) for 1 hour at room temperature, washed again and incubated with Alexa-488–conjugated secondary antibody for 45 minutes at room temperature. For each condition, 20,000 cells were recorded, and data from two replicate experiments were analyzed using the FlowJo software (V10.1).

Disclosure of Potential Conflicts of Interest

M. Robson is a consultant/advisory board member for AstraZeneca. No potential conflicts of interest were disclosed by the other authors.

Disclaimer

The content is solely the responsibility of the authors and does not necessarily represent the official views of the NIH, the U.S. Army, or the Department of Defense. The funding institutions had no role in the design and conduct of the study; collection, management, analysis, and interpretation of the data; preparation, review, or approval of the manuscript; and decision to submit the manuscript for publication.

Authors' Contributions

Conception and design: J. Vijai, S. Topka, L. Norton, K. Offit

Development of methodology: J. Vijai, S. Topka, S.N. Hart, F. Lejbkowicz

Acquisition of data (provided animals, acquired and managed patients, provided facilities, etc.): J. Vijai, S. Topka, D. Villano, V. Ravichandran, K.N. Maxwell, T. Thomas, P. Gaddam, B. Wenz, S.M. Lipkin, L. Zhang, Z.K. Stadler, J.N. Weitzel, S. Domchek, F.J. Couch, K.L. Nathanson, G. Rennert, K. Offit

Analysis and interpretation of data (e.g., statistical analysis, biostatistics, computational analysis): J. Vijai, S. Topka, D. Villano, V. Ravichandran, T. Thomas, S. Carmi, S.N. Hart, S.M. Lipkin, M.F. Walsh, F. Lejbkowicz, Z.K. Stadler, M.J. Daly, G. Rennert, K. Offit

Writing, review, and/or revision of the manuscript: J. Vijai, S. Topka, D. Villano, K.N. Maxwell, T. Thomas, S. Kazzaz, B. Wenz, K.A. Schrader, S.M. Lipkin, S.L. Neuhausen, M.F. Walsh, F. Lejbkowicz, Z.K. Stadler, M. Robson, J.N. Weitzel, S. Domchek, F.J. Couch, K.L. Nathanson, L. Norton, G. Rennert, K. Offit

Administrative, technical, or material support (i.e., reporting or organizing data, constructing databases): D. Villano, V. Ravichandran, K.N. Maxwell, A. Maria, P. Gaddam, A. Lincoln, S. Kazzaz, B. Wenz, H. Rennert, J.N. Weitzel, S. Domchek

Study supervision: J. Vijai, S.M. Lipkin, J.N. Weitzel, K. Offit

Other (team coordination): L. Norton

Grant Support

This work was supported by the Sharon Corzine Cancer Research Fund, The Robert and Kate Niehaus Center for Inherited Cancer Genomics, the Miele family initiative (K. Offit), and the Andrew Sabin Family Fund. This work was also supported by NIH R01CA176785 and the Breast Cancer Research Foundation (F.J. Couch, K.L. Nathanson, M. Robson, and K. Offit), R21-CA139396 (J. Vijai and Z.K. Stadler), and Department of Defense W81XWH-13- 1-0338 (K.L. Nathanson). This work was also supported by funds from the City of Hope Clinical Cancer Genetics Community Research Network and the Hereditary Cancer Research Registry, supported in part by Award Number RC4CA153828 (PI: J. Weitzel) from the National Cancer Institute and the Office of the Director, NIH. This work was also supported by the MSKCC Core grant NIH P30CA008748.

Acknowledgments

We thank the members of the Clalit National Israeli Cancer Control Center and Department of Community Medicine and Epidemiology, Carmel Medical Center and B Rappaport Faculty of Medicine, Haifa, Israel, and the New York Genome Center for the genotyping data. We also thank the members of the Ashkenazi Jewish Genome Project for the control genotypes, and Drs. Benezra and Mayr from MSKCC and Dr. Hoeijmakers from Erasmus University for cell lines and plasmids.

Footnotes

  • Note: Supplementary data for this article are available at Cancer Discovery Online (http://cancerdiscovery.aacrjournals.org/).

  • J. Vijai and S. Topka share first authorship of this article.

  • Received April 27, 2016.
  • Revision received September 14, 2016.
  • Accepted September 16, 2016.
  • ©2016 American Association for Cancer Research.

References

  1. 1.↵
    1. Couch FJ,
    2. Nathanson KL,
    3. Offit K
    . Two decades after BRCA: setting paradigms in personalized cancer care and prevention. Science 2014;343:1466–70.
    OpenUrlAbstract/FREE Full Text
  2. 2.↵
    1. Easton DF,
    2. Pharoah PD,
    3. Antoniou AC,
    4. Tischkowitz M,
    5. Tavtigian SV,
    6. Nathanson KL,
    7. et al.
    Gene-panel sequencing and the prediction of breast-cancer risk. N Engl J Med 2015;372:2243–57.
    OpenUrlCrossRefPubMed
  3. 3.↵
    1. Michailidou K,
    2. Beesley J,
    3. Lindstrom S,
    4. Canisius S,
    5. Dennis J,
    6. Lush MJ,
    7. et al.
    Genome-wide association analysis of more than 120,000 individuals identifies 15 new susceptibility loci for breast cancer. Nat Genet 2015;47:373–80.
    OpenUrlCrossRefPubMed
  4. 4.↵
    1. Risinger MA,
    2. Groden J
    . Crosslinks and crosstalk: human cancer syndromes and DNA repair defects. Cancer Cell 2004;6:539–45.
    OpenUrlPubMed
  5. 5.↵
    1. Brosh RM Jr.
    . DNA helicases involved in DNA repair and their roles in cancer. Nat Rev Cancer 2013;13:542–58.
    OpenUrlCrossRefPubMed
  6. 6.↵
    1. Petrovski S,
    2. Wang Q,
    3. Heinzen EL,
    4. Allen AS,
    5. Goldstein DB
    . Genic intolerance to functional variation and the interpretation of personal genomes. PLoS Genet 2013;9:e1003709.
    OpenUrlCrossRefPubMed
  7. 7.↵
    1. Vermeulen W,
    2. Scott RJ,
    3. Rodgers S,
    4. Muller HJ,
    5. Cole J,
    6. Arlett CF,
    7. et al.
    Clinical heterogeneity within xeroderma pigmentosum associated with mutations in the DNA repair and transcription gene ERCC3. Am J Hum Genet 1994;54:191–200.
    OpenUrlPubMed
  8. 8.↵
    1. Mcmorris TC,
    2. Kelner MJ,
    3. Wang W,
    4. Estes LA,
    5. Montoya MA,
    6. Taetle R
    . Structure-Activity-Relationships of Illudins – Analogs with Improved Therapeutic Index. J Org Chem 1992;57:6876–83.
    OpenUrlCrossRef
  9. 9.↵
    1. Marti TM,
    2. Hefner E,
    3. Feeney L,
    4. Natale V,
    5. Cleaver JE
    . H2AX phosphorylation within the G1 phase after UV irradiation depends on nucleotide excision repair and not DNA double-strand breaks. Proc Natl Acad Sci U S A 2006;103:9891–6.
    OpenUrlAbstract/FREE Full Text
  10. 10.↵
    1. Carmi S,
    2. Hui KY,
    3. Kochav E,
    4. Liu X,
    5. Xue J,
    6. Grady F,
    7. et al.
    Sequencing an Ashkenazi reference panel supports population-targeted personal genomics and illuminates Jewish and European origins. Nat Commun 2014;5:4835.
    OpenUrlCrossRefPubMed
  11. 11.↵
    1. Schaeffer L,
    2. Roy R,
    3. Humbert S,
    4. Moncollin V,
    5. Vermeulen W,
    6. Hoeijmakers JH,
    7. et al.
    DNA repair helicase: a component of BTF2 (TFIIH) basic transcription factor. Science 1993;260:58–63.
    OpenUrlAbstract/FREE Full Text
  12. 12.↵
    1. Oh K-S,
    2. Khan SG,
    3. Jaspers NGJ,
    4. Raams A,
    5. Ueda T,
    6. Lehmann A,
    7. et al.
    Phenotypic heterogeneity in the XPB DNA helicase gene (ERCC3): xeroderma pigmentosum without and with Cockayne syndrome. Hum Mut 2006;27:1092–103.
    OpenUrlCrossRefPubMed
  13. 13.↵
    1. Singh A,
    2. Compe E,
    3. Le May N,
    4. Egly JM
    . TFIIH subunit alterations causing xeroderma pigmentosum and trichothiodystrophy specifically disturb several steps during transcription. Am J Hum Genet 2015;96:194–207.
    OpenUrlCrossRefPubMed
  14. 14.↵
    1. Seemanova E
    . An increased risk for malignant neoplasms in heterozygotes for a syndrome of microcephaly, normal intelligence, growth retardation, remarkable facies, immunodeficiency and chromosomal instability. Mut Res 1990;238:321–4.
    OpenUrlPubMed
  15. 15.↵
    1. Digweed M,
    2. Reis A,
    3. Sperling K
    . Nijmegen breakage syndrome: consequences of defective DNA double strand break repair. BioEssays 1999;21:649–56.
    OpenUrlCrossRefPubMed
  16. 16.↵
    1. Bassing CH,
    2. Suh H,
    3. Ferguson DO,
    4. Chua KF,
    5. Manis J,
    6. Eckersdorff M,
    7. et al.
    Histone H2AX: a dosage-dependent suppressor of oncogenic translocations and tumors. Cell 2003;114:359–70.
    OpenUrlCrossRefPubMed
  17. 17.↵
    1. Celeste A,
    2. Difilippantonio S,
    3. Difilippantonio MJ,
    4. Fernandez-Capetillo O,
    5. Pilch DR,
    6. Sedelnikova OA,
    7. et al.
    H2AX haploinsufficiency modifies genomic stability and tumor susceptibility. Cell 2003;114:371–83.
    OpenUrlCrossRefPubMed
  18. 18.↵
    1. Goss KH,
    2. Risinger MA,
    3. Kordich JJ,
    4. Sanz MM,
    5. Straughen JE,
    6. Slovek LE,
    7. et al.
    Enhanced tumor formation in mice heterozygous for Blm mutation. Science 2002;297:2051–3.
    OpenUrlAbstract/FREE Full Text
  19. 19.↵
    1. Lam MH,
    2. Liu Q,
    3. Elledge SJ,
    4. Rosen JM
    . Chk1 is haploinsufficient for multiple functions critical to tumor suppression. Cancer Cell 2004;6:45–59.
    OpenUrlCrossRefPubMed
  20. 20.↵
    1. Nikkila J,
    2. Parplys AC,
    3. Pylkas K,
    4. Bose M,
    5. Huo Y,
    6. Borgmann K,
    7. et al.
    Heterozygous mutations in PALB2 cause DNA replication and damage response defects. Nat Commun 2013;4:2578.
    OpenUrlPubMed
  21. 21.↵
    1. Andressoo JO,
    2. Weeda G,
    3. de Wit J,
    4. Mitchell JR,
    5. Beems RB,
    6. van Steeg H,
    7. et al.
    An Xpb mouse model for combined xeroderma pigmentosum and cockayne syndrome reveals progeroid features upon further attenuation of DNA repair. Mol Cell Biol 2009;29:1276–90.
    OpenUrlAbstract/FREE Full Text
  22. 22.↵
    1. Diderich K,
    2. Alanazi M,
    3. Hoeijmakers JH
    . Premature aging and cancer in nucleotide excision repair-disorders. DNA Repair (Amst) 2011;10:772–80.
    OpenUrlCrossRefPubMed
  23. 23.↵
    1. Itoh T,
    2. Cado D,
    3. Kamide R,
    4. Linn S
    . DDB2 gene disruption leads to skin tumors and resistance to apoptosis after exposure to ultraviolet light but not a chemical carcinogen. Proc Natl Acad Sci U S A 2004;101:2052–7.
    OpenUrlAbstract/FREE Full Text
  24. 24.↵
    1. Cheo DL,
    2. Meira LB,
    3. Burns DK,
    4. Reis AM,
    5. Issac T,
    6. Friedberg EC
    . Ultraviolet B radiation-induced skin cancer in mice defective in the Xpc, Trp53, and Apex (HAP1) genes: genotype-specific effects on cancer predisposition and pathology of tumors. Cancer Res 2000;60:1580–4.
    OpenUrlAbstract/FREE Full Text
  25. 25.↵
    1. Wijnhoven SW,
    2. Kool HJ,
    3. Mullenders LH,
    4. van Zeeland AA,
    5. Friedberg EC,
    6. van der Horst GT,
    7. et al.
    Age-dependent spontaneous mutagenesis in Xpc mice defective in nucleotide excision repair. Oncogene 2000;19:5034–7.
    OpenUrlCrossRefPubMed
  26. 26.↵
    1. Andressoo JO,
    2. Mitchell JR,
    3. de Wit J,
    4. Hoogstraten D,
    5. Volker M,
    6. Toussaint W,
    7. et al.
    An Xpd mouse model for the combined xeroderma pigmentosum/Cockayne syndrome exhibiting both cancer predisposition and segmental progeria. Cancer Cell 2006;10:121–32.
    OpenUrlCrossRefPubMed
  27. 27.↵
    1. Shaag A,
    2. Walsh T,
    3. Renbaum P,
    4. Kirchhoff T,
    5. Nafa K,
    6. Shiovitz S,
    7. et al.
    Functional and genomic approaches reveal an ancient CHEK2 allele associated with breast cancer in the Ashkenazi Jewish population. Hum Mol Genet 2005;14:555–63.
    OpenUrlAbstract/FREE Full Text
  28. 28.↵
    1. Redston M,
    2. Nathanson KL,
    3. Yuan ZQ,
    4. Neuhausen SL,
    5. Satagopan J,
    6. Wong N,
    7. et al.
    The APCI1307K allele and breast cancer risk. Nat Genet 1998;20:13–4.
    OpenUrlCrossRefPubMed
  29. 29.↵
    1. Weischer M,
    2. Bojesen SE,
    3. Ellervik C,
    4. Tybjaerg-Hansen A,
    5. Nordestgaard BG
    . CHEK2*1100delC genotyping for clinical assessment of breast cancer risk: meta-analyses of 26,000 patient cases and 27,000 controls. J Clin Oncol 2008;26:542–8.
    OpenUrlAbstract/FREE Full Text
  30. 30.↵
    1. Alanee S,
    2. Couch F,
    3. Offit K
    . Association of a HOXB13 variant with breast cancer. N Engl J Med 2012;367:480–1.
    OpenUrlPubMed
  31. 31.↵
    1. Erkko H,
    2. Xia B,
    3. Nikkila J,
    4. Schleutker J,
    5. Syrjakoski K,
    6. Mannermaa A,
    7. et al.
    A recurrent mutation in PALB2 in Finnish cancer families. Nature 2007;446:316–9.
    OpenUrlCrossRefPubMed
  32. 32.↵
    1. Schnurbein G,
    2. Hauke J,
    3. Wappenschmidt B,
    4. Weber-Lassalle N,
    5. Engert S,
    6. Hellebrand H,
    7. et al.
    RAD51C deletion screening identifies a recurrent gross deletion in breast cancer and ovarian cancer families. Breast Cancer Res 2013;15:R120.
    OpenUrlPubMed
  33. 33.↵
    1. Goyal G,
    2. Fan T,
    3. Silberstein PT
    . Hereditary cancer syndromes: utilizing DNA repair deficiency as therapeutic target. Fam Cancer 2016;15:359–66.
    OpenUrlPubMed
  34. 34.↵
    1. Sonnenblick A,
    2. de Azambuja E,
    3. Azim HA Jr..,
    4. Piccart M
    . An update on PARP inhibitors–moving to the adjuvant setting. Nat Rev Clin Oncol 2015;12:27–41.
    OpenUrlPubMed
  35. 35.↵
    1. Chen MC,
    2. Zhou B,
    3. Zhang K,
    4. Yuan YC,
    5. Un F,
    6. Hu S,
    7. et al.
    The novel ribonucleotide reductase inhibitor COH29 inhibits DNA repair in vitro. Mol Pharmacol 2015;87:996–1005.
    OpenUrlAbstract/FREE Full Text
  36. 36.↵
    1. Lok BH,
    2. Powell SN
    . Molecular pathways: understanding the role of Rad52 in homologous recombination for therapeutic advancement. Clin Cancer Res 2012;18:6400–6.
    OpenUrlAbstract/FREE Full Text
  37. 37.↵
    1. Zhang F
    . Genome Engineering Resources—Zhang Lab @ MIT. N.p., 2013. Web. 01 Apr. 2016. <http:www.genome-engineering.org/>
PreviousNext
Back to top
Cancer Discovery: 6 (11)
November 2016
Volume 6, Issue 11
  • Table of Contents
  • Table of Contents (PDF)
  • About the Cover
  • Editorial Board (PDF)

Sign up for alerts

View this article with LENS

Open full page PDF
Article Alerts
Sign In to Email Alerts with your Email Address
Email Article

Thank you for sharing this Cancer Discovery article.

NOTE: We request your email address only to inform the recipient that it was you who recommended this article, and that it is not junk mail. We do not retain these email addresses.

Enter multiple addresses on separate lines or separate them with commas.
A Recurrent ERCC3 Truncating Mutation Confers Moderate Risk for Breast Cancer
(Your Name) has forwarded a page to you from Cancer Discovery
(Your Name) thought you would be interested in this article in Cancer Discovery.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.
Citation Tools
A Recurrent ERCC3 Truncating Mutation Confers Moderate Risk for Breast Cancer
Joseph Vijai, Sabine Topka, Danylo Villano, Vignesh Ravichandran, Kara N. Maxwell, Ann Maria, Tinu Thomas, Pragna Gaddam, Anne Lincoln, Sarah Kazzaz, Brandon Wenz, Shai Carmi, Kasmintan A. Schrader, Steven N. Hart, Steve M. Lipkin, Susan L. Neuhausen, Michael F. Walsh, Liying Zhang, Flavio Lejbkowicz, Hedy Rennert, Zsofia K. Stadler, Mark Robson, Jeffrey N. Weitzel, Susan Domchek, Mark J. Daly, Fergus J. Couch, Katherine L. Nathanson, Larry Norton, Gad Rennert and Kenneth Offit
Cancer Discov November 1 2016 (6) (11) 1267-1275; DOI: 10.1158/2159-8290.CD-16-0487

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Share
A Recurrent ERCC3 Truncating Mutation Confers Moderate Risk for Breast Cancer
Joseph Vijai, Sabine Topka, Danylo Villano, Vignesh Ravichandran, Kara N. Maxwell, Ann Maria, Tinu Thomas, Pragna Gaddam, Anne Lincoln, Sarah Kazzaz, Brandon Wenz, Shai Carmi, Kasmintan A. Schrader, Steven N. Hart, Steve M. Lipkin, Susan L. Neuhausen, Michael F. Walsh, Liying Zhang, Flavio Lejbkowicz, Hedy Rennert, Zsofia K. Stadler, Mark Robson, Jeffrey N. Weitzel, Susan Domchek, Mark J. Daly, Fergus J. Couch, Katherine L. Nathanson, Larry Norton, Gad Rennert and Kenneth Offit
Cancer Discov November 1 2016 (6) (11) 1267-1275; DOI: 10.1158/2159-8290.CD-16-0487
del.icio.us logo Digg logo Reddit logo Twitter logo CiteULike logo Facebook logo Google logo Mendeley logo
  • Tweet Widget
  • Facebook Like
  • Google Plus One

Jump to section

  • Article
    • Abstract
    • Introduction
    • Results
    • Discussion
    • Methods
    • Disclosure of Potential Conflicts of Interest
    • Disclaimer
    • Authors' Contributions
    • Grant Support
    • Acknowledgments
    • Footnotes
    • References
  • Figures & Data
  • Info & Metrics
  • PDF
Advertisement

Related Articles

Cited By...

More in this TOC Section

  • Fas Mediates Bystander Tumor Killing by T Cells
  • Immune Checkpoint Inhibitor Myocarditis in Mice
  • Genetic Ancestry Impacts Somatic Alterations in Lung Cancers
Show more Research Briefs
  • Home
  • Alerts
  • Feedback
  • Privacy Policy
Facebook   Twitter   LinkedIn   YouTube   RSS

Articles

  • OnlineFirst
  • Current Issue
  • Past Issues

Info For

  • Authors
  • Subscribers
  • Advertisers
  • Librarians

About Cancer Discovery

  • About the Journal
  • Editors
  • Journal Sections
  • Permissions
  • Submit a Manuscript
AACR logo

Copyright © 2021 by the American Association for Cancer Research.

Cancer Discovery
eISSN: 2159-8290
ISSN: 2159-8274

Advertisement